Characterization of G6PD genotypes and phenotypes on the northwestern Thailand-Myanmar border.

Article Details

Citation

Copy to clipboard

Bancone G, Chu CS, Somsakchaicharoen R, Chowwiwat N, Parker DM, Charunwatthana P, White NJ, Nosten FH

Characterization of G6PD genotypes and phenotypes on the northwestern Thailand-Myanmar border.

PLoS One. 2014 Dec 23;9(12):e116063. doi: 10.1371/journal.pone.0116063. eCollection 2014.

PubMed ID

25536053 [ View in PubMed

]

Abstract

Mutations in the glucose-6-phosphate dehydrogenase (G6PD) gene result in red blood cells with increased susceptibility to oxidative damage. Significant haemolysis can be caused by primaquine and other 8-aminoquinoline antimalarials used for the radical treatment of Plasmodium vivax malaria. The distribution and phenotypes of mutations causing G6PD deficiency in the male population of migrants and refugees in a malaria endemic region on the Thailand-Myanmar border were characterized. Blood samples for G6PD fluorescent spot test (FST), G6PD genotyping, and malaria testing were taken from 504 unrelated males of Karen and Burman ethnicities presenting to the outpatient clinics. The overall frequency of G6PD deficiency by the FST was 13.7%. Among the deficient subjects, almost 90% had the Mahidol variant (487G>A) genotype. The remaining subjects had Chinese-4 (392G>T), Viangchan (871G>A), Acores (595A>G), Seattle (844G>C) and Mediterranean (563C>T) variants. Quantification of G6PD activity was performed using a modification of the standard spectrophotometric assay on a subset of 24 samples with Mahidol, Viangchan, Seattle and Chinese-4 mutations; all samples showed a residual enzymatic activity below 10% of normal and were diagnosed correctly by the FST. Further studies are needed to characterise the haemolytic risk of using 8-aminoquinolines in patients with these genotypes.

DrugBank Data that Cites this Article

Pharmaco-genomics

Drug	Interacting Gene/Enzyme	Allele name	Genotypes	Defining change(s)	Type(s)	Description	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Villeurbanne	Not Available	1000_1002delACC	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Torun	Not Available	1006A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Sunderland	Not Available	105_107delCAT	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Iwatsuki	Not Available	1081G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Serres	Not Available	1082C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Tondela	Not Available	1084_1101delCTGAACGAGCGCAAGGCC	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Loma Linda	Not Available	1089C->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Aachen	Not Available	1089C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Tenri	Not Available	1096A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Montpellier	Not Available	1132G>A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Calvo Mackenna	Not Available	1138A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Riley	Not Available	1139T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Olomouc	Not Available	1141T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Tomah	Not Available	1153T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Lynwood	Not Available	1154G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Madrid	Not Available	1155C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Iowa, Walter Reed, Springfield	Not Available	1156A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Beverly Hills, Genova, Iwate, Niigata, Yamaguchi	Not Available	1160G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Hartford	Not Available	1162A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Praha	Not Available	1166A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Krakow	Not Available	1175T>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Wisconsin	Not Available	1177C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Nashville, Anaheim, Portici	Not Available	1178G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Alhambra	Not Available	1180G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Bari	Not Available	1187C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Puerto Limon	Not Available	1192G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Covao do Lobo	Not Available	1205C>A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Clinic	Not Available	1215G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Utrecht	Not Available	1225C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Suwalki	Not Available	1226C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Riverside	Not Available	1228G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Japan, Shinagawa	Not Available	1229G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kawasaki	Not Available	1229G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Munich	Not Available	1231A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Georgia	Not Available	1284C->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Sumare	Not Available	1292T->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Telti/Kobe	Not Available	1318C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Santiago de Cuba, Morioka	Not Available	1339G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Harima	Not Available	1358T->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Figuera da Foz	Not Available	1366G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Amiens	Not Available	1367A>T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Bangkok Noi	Not Available	1376G->T, 1502T->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Fukaya	Not Available	1462G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Campinas	Not Available	1463G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Buenos Aires	Not Available	1465C>T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Arakawa	Not Available	1466C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Brighton	Not Available	1488_1490delGAA	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kozukata	Not Available	159G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Amsterdam	Not Available	180_182delTCT	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	No name	Not Available	202G->A, 376A->G, 1264C>G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Swansea	Not Available	224T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Urayasu	Not Available	281_283delAGA	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Vancouver	Not Available	317C->G544C->T592C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Mt Sinai	Not Available	376A->G, 1159C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Plymouth	Not Available	488G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Volendam	Not Available	514C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Shinshu	Not Available	527A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Chikugo	Not Available	535A->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Tsukui	Not Available	561_563delCTC	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Pedoplis-Ckaro	Not Available	573C>G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Santiago	Not Available	593G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Minnesota, Marion, Gastonia, LeJeune	Not Available	637G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Cincinnati	Not Available	637G->T, 1037A->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Harilaou	Not Available	648T->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	North Dallas	Not Available	683_685delACA	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Asahikawa	Not Available	695G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Durham	Not Available	713A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Stonybrook	Not Available	724_729delGGCACT	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Wayne	Not Available	769C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Aveiro	Not Available	806G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Cleveland Corum	Not Available	820G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Lille	Not Available	821A>T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Bangkok	Not Available	825G>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Sugao	Not Available	826C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	La Jolla	Not Available	832T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Wexham	Not Available	833C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Piotrkow	Not Available	851T>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	West Virginia	Not Available	910G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Omiya	Not Available	921G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Nara	Not Available	953_976delCCACCAAAGGGTACCTGGAC GACC	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Manhattan	Not Available	962G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Rehevot	Not Available	964T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Honiara	Not Available	99A->G 1360C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Tokyo, Fukushima	Not Available	1246G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Chatham	Not Available	1003G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Fushan	Not Available	1004C->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Partenope	Not Available	1052G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Ierapetra	Not Available	1057C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Anadia	Not Available	1193A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Abeno	Not Available	1220A->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Surabaya	Not Available	1291G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Pawnee	Not Available	1316G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	S. Antioco	Not Available	1342A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Cassano	Not Available	1347G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Hermoupolis	Not Available	1347G->C 1360C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Union,Maewo, Chinese-2, Kalo	Not Available	1360C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Andalus	Not Available	1361G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Cosenza	Not Available	1376G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Canton, Taiwan- Hakka, Gifu-like, Agrigento-like	Not Available	1376G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Flores	Not Available	1387C->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kaiping, Anant, Dhon, Sapporo-like, Wosera	Not Available	1388G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kamogawa	Not Available	169C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Costanzo	Not Available	179T>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Amazonia	Not Available	185C->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Songklanagarind	Not Available	196T->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Hechi	Not Available	202G->A 871G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Namouru	Not Available	208T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Bao Loc	Not Available	352T>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Crispim	Not Available	375G->T, 379G->T383T->C384C>T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Acrokorinthos	Not Available	376A->G 463C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Santa Maria	Not Available	376A->G 542A->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Ananindeua	Not Available	376A->G 871G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Vanua Lava	Not Available	383T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Valladolid	Not Available	406C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Belem	Not Available	409C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Liuzhou	Not Available	442G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Shenzen	Not Available	473G>A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Taipei “Chinese- 3”	Not Available	493A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Toledo	Not Available	496C>T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Naone	Not Available	497G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Nankang	Not Available	517T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Miaoli	Not Available	519C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham	Not Available	563C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Coimbra Shunde	Not Available	592C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Nilgiri	Not Available	593G>A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Radlowo	Not Available	679C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Roubaix	Not Available	811G>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Haikou	Not Available	835A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Chinese-1	Not Available	835A->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Mizushima	Not Available	848A>G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Osaka	Not Available	853C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Viangchan, Jammu	Not Available	871G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Seoul	Not Available	916G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Ludhiana	Not Available	929G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Farroupilha	Not Available	977C->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Chinese-5	Not Available	1024C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Rignano	Not Available	130G>A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Orissa	Not Available	131C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	G6PDNice	Not Available	1380G>C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kamiube, Keelung	Not Available	1387C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Neapolis	Not Available	1400C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Aures	Not Available	143T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Split	Not Available	1442C->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kambos	Not Available	148C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Palestrina	Not Available	170G>A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Metaponto	Not Available	172G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Musashino	Not Available	185C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Asahi	Not Available	202G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	A- (202), Ferrara I	Not Available	202G->A 376A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Murcia Oristano	Not Available	209A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Ube Konan	Not Available	241C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Lagosanto	Not Available	242G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Guangzhou	Not Available	274C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Hammersmith	Not Available	323T->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Sinnai	Not Available	34G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	A- (680)	Not Available	376A->G 680G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	A- (968), Betica,Selma, Guantanamo	Not Available	376A->G 968T->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Salerno Pyrgos	Not Available	383T>G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Quing Yan	Not Available	392G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Lages	Not Available	40G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Ilesha	Not Available	466G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Mahidol	Not Available	487G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Malaga	Not Available	542A->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Sibari	Not Available	634A->G	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Mexico City	Not Available	680G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Nanning	Not Available	703C->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Seattle, Lodi, Modena, Ferrara II, Athens-like	Not Available	844G->C	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Bajo Maumere	Not Available	844G->T	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Montalbano	Not Available	854G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Kalyan-Kerala, Jamnaga, Rohini	Not Available	949G->A	ADR Inferred	Increased risk of hematological effects.	Details
Chloroquine	Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413	Gaohe	Not Available	95A->G	ADR Inferred	Increased risk of hematological effects.	Details