Alpha-7 nicotinic cholinergic receptor subunit
Details
- Name
- Alpha-7 nicotinic cholinergic receptor subunit
- Kind
- protein
- Synonyms
- Not Available
- Gene Name
- CHRNA7
- UniProtKB Entry
- Q693P7TrEMBL
- Organism
- Humans
- NCBI Taxonomy ID
- 9606
- Amino acid sequence
>lcl|BSEQ0022322|Alpha-7 nicotinic cholinergic receptor subunit ITVLLSLTVFMLLVAEIMPATSDSVPLI
- Number of residues
- 28
- Molecular Weight
- 2987.635
- Theoretical pI
- 3.55
- GO Classification
- Processesion transportComponentsintegral component of membrane
- General Function
- Not Available
- Specific Function
- Not Available
- Pfam Domain Function
- Neur_chan_memb (PF02932)
- Signal Regions
- 1-22
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0006706|87 bp GGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCTGAGATCATGCCCG CAACATCCGATTCGGTACCATTGATAG
- Chromosome Location
- Not Available
- Locus
- Not Available
- External Identifiers
Resource Link UniProtKB ID Q693P7 UniProtKB Entry Name Q693P7_HUMAN GenBank Gene ID AY641831 GenAtlas ID CHRFAM7A - General References
- Not Available
Associated Data
- Drug Relations
- Not Available