Pharmacogenomic Effect/ADR for Fluorouracil (DBSNPE000040)

Identifier
DBSNPE000040
Drug
Fluorouracil (DB00544)
Interacting Gene/Enzyme
Thymidylate synthase
Gene Name
TYMS
UniProt ID
P04818
Defining Change(s)
(CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/3/4rs34743033
Allele Name
TSER*2
Genotype(s)
Not Available
Type(s)
ADR Directly Studied
Groups
Not Available
Description
Patients with this genotype have increased risk of severe neutropenia or severe diarrhea with [drug; fluorouracil].
References
  1. Ichikawa W, Takahashi T, Suto K, Sasaki Y, Hirayama R: Orotate phosphoribosyltransferase gene polymorphism predicts toxicity in patients treated with bolus 5-fluorouracil regimen. Clin Cancer Res. 2006 Jul 1;12(13):3928-34. [Article]