IMT504
Star0
This drug entry is a stub and has not been fully annotated. It is scheduled to be annotated soon.
Explore a selection of our essential drug information below, or:
Identification
- Generic Name
- IMT504
- DrugBank Accession Number
- DB17792
- Background
IMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.1
- Type
- Biotech
- Groups
- Investigational
- Biologic Classification
- Vaccines
Other vaccines - Synonyms
- DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T)
- IMT 504
- IMT-504
- PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'
Pharmacology
- Indication
Not Available
Reduce drug development failure ratesBuild, train, & validate machine-learning modelswith evidence-based and structured datasets.Build, train, & validate predictive machine-learning models with structured datasets.- Contraindications & Blackbox Warnings
- Prevent Adverse Drug Events TodayTap into our Clinical API for life-saving information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.Avoid life-threatening adverse drug events with our Clinical API
- Pharmacodynamics
Not Available
- Mechanism of action
- Not Available
- Absorption
Not Available
- Volume of distribution
Not Available
- Protein binding
Not Available
- Metabolism
- Not Available
- Route of elimination
Not Available
- Half-life
Not Available
- Clearance
Not Available
- Adverse Effects
- Improve decision support & research outcomesWith structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates. View sample adverse effects data in our new Data Library!Improve decision support & research outcomes with our structured adverse effects data.
- Toxicity
Not Available
- Pathways
- Not Available
- Pharmacogenomic Effects/ADRs
- Not Available
Interactions
- Drug Interactions
- This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.Not Available
- Food Interactions
- Not Available
Categories
- Drug Categories
- Classification
- Not classified
- Affected organisms
- Not Available
Chemical Identifiers
- UNII
- 8A805B1IH6
- CAS number
- Not Available
References
- General References
- Franco R, Rodriguez JM, Elias F, Hernando-Insua A, Flo J, Lopez R, Nagle C, Lago N, Zorzopulos J, Horn DL, Montaner AD: Non-clinical safety studies of IMT504, a unique non-CpG oligonucleotide. Nucleic Acid Ther. 2014 Aug;24(4):267-82. doi: 10.1089/nat.2013.0479. Epub 2014 Apr 10. [Article]
- External Links
- Not Available
Clinical Trials
- Clinical Trials
Phase Status Purpose Conditions Count 1 Recruiting Treatment Immune System 1
Pharmacoeconomics
- Manufacturers
- Not Available
- Packagers
- Not Available
- Dosage Forms
- Not Available
- Prices
- Not Available
- Patents
- Not Available
Properties
- State
- Not Available
- Experimental Properties
- Not Available
Drug created at May 11, 2023 17:47 / Updated at July 07, 2023 12:10