


Rasburicase is a recombinant form of urate-oxidase enzyme used to treat hyperuricemia following chemotherapy for leukemias and non-Hodgkin's lymphoma.

Brand Names
Elitek, Fasturtec
Generic Name
DrugBank Accession Number

Rasburicase is a recombinant urate-oxidase enzyme produced by a genetically modified Saccharomyces cerevisiae strain. The cDNA coding for rasburicase was cloned from a strain of Aspergillus flavus.

Approved, Investigational
Biologic Classification
Protein Based Therapies
Recombinant Enzymes
Protein Structure
Protein Chemical Formula
Protein Average Weight
34109.5 Da
>DB00049 sequence
Download FASTA Format
  • Rasburicasa
  • Rasburicase
  • Urate oxidase
External IDs
  • SR 29142
  • SR29142



For treatment of hyperuricemia, reduces elevated plasma uric acid levels (from chemotherapy)

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Conditions
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Drugs used to treat lympohoid leukemia, non-Hodgkin's lymphoma and acute myelogenous leukemia often lead to the accumulation of toxic plasma levels of purine metabolites (i.e. uric acid). The injection of rasburicase reduces levels of uric acid and mitigates the toxic effects of chemotherapy induced tumor lysis.

Mechanism of action

Rasburicase catalyzes enzymatic oxidation of uric acid into an inactive and soluble metabolite (allantoin).

AUric acid

Not Available

Volume of distribution
  • 110 to 127 mL/kg [pediatric patients]
  • 75.8 to 138 mL/kg [adult patients]
Protein binding

Not Available

Not Available
Route of elimination

Not Available


18 hours


Not Available

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

Not Available

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredAcute hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredAcute hemolytic anemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AcetaminophenThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Acetaminophen.
Aminosalicylic acidThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Aminosalicylic acid.
Amyl NitriteThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Amyl Nitrite.
AntipyrineThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Antipyrine.
ArticaineThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Articaine.
BendroflumethiazideThe therapeutic efficacy of Rasburicase can be decreased when used in combination with Bendroflumethiazide.
BenzocaineThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Benzocaine.
BenzthiazideThe therapeutic efficacy of Rasburicase can be decreased when used in combination with Benzthiazide.
BupivacaineThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Bupivacaine.
ButalbitalThe risk or severity of methemoglobinemia can be increased when Rasburicase is combined with Butalbital.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
No interactions found.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
Elitek1.5 mg/1mLIntravenoussanofi-aventis U.S. LLC2002-07-12Not applicableUS flag
Elitek7.5 mg/5mLIntravenoussanofi-aventis U.S. LLC2006-06-01Not applicableUS flag
FasturtecInjection, powder, for solution1.5 mg/mlIntravenousSanofi Aventis Groupe2016-09-08Not applicableEU flag
FasturtecInjection, powder, for solution1.5 mg/mlIntravenousSanofi Aventis Groupe2016-09-08Not applicableEU flag
FasturtecPowder, for solution7.5 mg / vialIntravenousSanofi AventisNot applicableNot applicableCanada flag
FasturtecPowder, for solution1.5 mg / vialIntravenousSanofi Aventis2004-09-21Not applicableCanada flag


ATC Codes
V03AF07 — RasburicaseM04AX01 — Urate oxidase
Drug Categories
Chemical TaxonomyProvided by Classyfire
Not Available
Organic Compounds
Super Class
Organic Acids
Carboxylic Acids and Derivatives
Sub Class
Amino Acids, Peptides, and Analogues
Direct Parent
Alternative Parents
Not Available
Not Available
Molecular Framework
Not Available
External Descriptors
Not Available
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number


Synthesis Reference

Roy Eugene Snoke, Hugh Arthur Risley, Charles Thomas Goodhue, "Production of uricase from micrococcus luteus." U.S. Patent US4062731, issued May, 1974.

General References
  1. Collings I, Watier Y, Giffard M, Dagogo S, Kahn R, Bonnete F, Wright JP, Fitch AN, Margiolaki I: Polymorphism of microcrystalline urate oxidase from Aspergillus flavus. Acta Crystallogr D Biol Crystallogr. 2010 May;66(Pt 5):539-48. doi: 10.1107/S0907444910005354. Epub 2010 Apr 21. [Article]
  2. Giraldez M, Puto K: A single, fixed dose of rasburicase (6 mg maximum) for treatment of tumor lysis syndrome in adults. Eur J Haematol. 2010 Aug;85(2):177-9. doi: 10.1111/j.1600-0609.2010.01457.x. Epub 2010 Apr 12. [Article]
PubChem Substance
RxList Drug Page
Drugs.com Drug Page
FDA label
Download (49.1 KB)

Clinical Trials

Clinical Trials
4CompletedPreventionHyperuricemia / Tumors / Tumour lysis syndrome1
4CompletedTreatmentMalignant Lymphomas1
4CompletedTreatmentTumour lysis syndrome1
4Not Yet RecruitingTreatmentHematopoietic and Lymphoid Cell Neoplasm / Malignant Solid Neoplasms / Tumour lysis syndrome1
3CompletedPreventionHyperuricemia / Malignancies / Tumour lysis syndrome1
3CompletedTreatmentHigh Grade Lymphomas / Leukemia, Lymphocytic, Acute, Adult1
2CompletedTreatmentChildhood Burkitt Lymphoma / Childhood Diffuse Large Cell Lymphoma / Childhood Immunoblastic Large Cell Lymphoma / Stage I Childhood Large Cell Lymphoma / Stage I Childhood Small Noncleaved Cell Lymphoma / Stage II Childhood Large Cell Lymphoma / Stage II Childhood Small Noncleaved Cell Lymphoma / Stage III Childhood Large Cell Lymphoma / Stage III Childhood Small Noncleaved Cell Lymphoma / Stage IV Childhood Large Cell Lymphoma / Stage IV Childhood Small Noncleaved Cell Lymphoma / Untreated Childhood Acute Lymphoblastic Leukemia1


Not Available
  • GlaxoSmithKline Inc.
  • Sanofi-Aventis Inc.
Dosage Forms
Injection, powder, for solutionIntravenous1.5 mg/ml
Powder, for solutionIntravenous1.5 mg / vial
Powder, for solutionIntravenous7.5 mg / vial
Injection, powder, lyophilized, for solutionIntravenous1.5 mg
Unit descriptionCostUnit
Elitek 7.5 mg vial3136.18USD vial
Elitek 1.5 mg vial627.23USD vial
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
CA2175971No2003-12-302016-05-07Canada flag
CA2148537No2002-07-162015-05-03Canada flag


Experimental Properties
hydrophobicity-0.465Not Available
isoelectric point7.16Not Available


Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock new
insights and accelerate drug research.
Learn more
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
Learn more
Small molecule
Pharmacological action
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [Article]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [Article]
  3. Cete S, Yasar A, Arslan F: An amperometric biosensor for uric acid determination prepared from uricase immobilized in polypyrrole film. Artif Cells Blood Substit Immobil Biotechnol. 2006;34(3):367-80. [Article]
  4. Gabison L, Chiadmi M, Colloc'h N, Castro B, El Hajji M, Prange T: Recapture of [S]-allantoin, the product of the two-step degradation of uric acid, by urate oxidase. FEBS Lett. 2006 Apr 3;580(8):2087-91. Epub 2006 Mar 10. [Article]
  5. Zhao Y, Zhao L, Yang G, Tao J, Bu Y, Liao F: Characterization of a uricase from Bacillus fastidious A.T.C.C. 26904 and its application to serum uric acid assay by a patented kinetic uricase method. Biotechnol Appl Biochem. 2006 Sep;45(Pt 2):75-80. [Article]
  6. Giraldez M, Puto K: A single, fixed dose of rasburicase (6 mg maximum) for treatment of tumor lysis syndrome in adults. Eur J Haematol. 2010 Aug;85(2):177-9. doi: 10.1111/j.1600-0609.2010.01457.x. Epub 2010 Apr 12. [Article]

Drug created on June 13, 2005 13:24 / Updated on September 19, 2021 19:53