IMT504

DB17792InvestigationalNucleic Acid Based Therapies

IMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.

Mechanism: Pharmacologically active on Toll-like receptor 9
Curator reviewed
Also known as: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T) · PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'
Code names: IMT504

Resolves to

Compound

Targets

What you can answer from here — as of September 25, 2026

1Protein targetEach mapped to UniProt, with action and pharmacological action

Listed above

1Clinical trialPhase, status and sponsor resolved per trial

2+ReferencesStructured and connected to the statements they support

Which drugs share a target with IMT504, and which of those have an active Phase 3 trial?

Create a free account or log in to explore the full data card.