Metallothionein-3

Details

Name
Metallothionein-3
Kind
protein
Synonyms
  • GIF
  • GIFB
  • Growth inhibitory factor
  • Metallothionein-III
  • MT-3
  • MT-III
Gene Name
MT3
UniProtKB Entry
P25713Swiss-Prot
Organism
Humans
NCBI Taxonomy ID
9606
Amino acid sequence
>lcl|BSEQ0017834|Metallothionein-3
MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE
AEKCSCCQ
Number of residues
68
Molecular Weight
6926.855
Theoretical pI
Not Available
GO Classification
Functions
metal ion binding
Processes
cellular detoxification / cellular response to copper ion / cellular response to reactive oxygen species / cellular response to zinc ion / detoxification of copper ion / intracellular monoatomic cation homeostasis / intracellular zinc ion homeostasis / negative regulation of neuron projection development / positive regulation of DNA-templated transcription / zinc ion transport
Components
cytosol / nucleus
General Function
Binds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro
Specific Function
Antioxidant activity
Pfam Domain Function
Signal Regions
Not Available
Transmembrane Regions
Not Available
Cellular Location
Not Available
Gene sequence
>lcl|BSEQ0017835|Metallothionein-3 (MT3)
ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC
AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG
GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA
GCAGAGAAGTGCAGCTGCTGCCAGTGA
Chromosome Location
16
Locus
16q13
External Identifiers
ResourceLink
UniProtKB IDP25713
UniProtKB Entry NameMT3_HUMAN
GeneCard IDMT3
HGNC IDHGNC:7408
PDB ID(s)2F5H, 2FJ4, 2FJ5
KEGG IDhsa:4504
NCBI Gene ID4504
General References
  1. Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47. [Article]
  2. Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7. [Article]
  3. Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50. [Article]
  4. Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7. [Article]
  5. Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45. [Article]
  6. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [Article]

Associated Data

Drug Relations
DrugDrug groupPharmacological action?TypeActionsDetails
Zincapproved, investigationalunknowntargetDetails
Zinc acetateapproved, investigationalunknowntargetDetails
Zinc chlorideapproved, investigationalunknowntargetcofactorDetails
Zinc sulfate, unspecified formapproved, experimentalunknowntargetcofactorDetails