Metallothionein-3
Details
- Name
- Metallothionein-3
- Kind
- protein
- Synonyms
- GIF
- GIFB
- Growth inhibitory factor
- Metallothionein-III
- MT-3
- MT-III
- Gene Name
- MT3
- UniProtKB Entry
- P25713Swiss-Prot
- Organism
- Humans
- NCBI Taxonomy ID
- 9606
- Amino acid sequence
>lcl|BSEQ0017834|Metallothionein-3 MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE AEKCSCCQ
- Number of residues
- 68
- Molecular Weight
- 6926.855
- Theoretical pI
- Not Available
- GO Classification
- Functionsmetal ion bindingProcessescellular detoxification / cellular response to copper ion / cellular response to reactive oxygen species / cellular response to zinc ion / detoxification of copper ion / intracellular monoatomic cation homeostasis / intracellular zinc ion homeostasis / negative regulation of neuron projection development / positive regulation of DNA-templated transcription / zinc ion transportComponentscytosol / nucleus
- General Function
- Binds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro
- Specific Function
- Antioxidant activity
- Pfam Domain Function
- Metallothio (PF00131)
- Signal Regions
- Not Available
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0017835|Metallothionein-3 (MT3) ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA GCAGAGAAGTGCAGCTGCTGCCAGTGA
- Chromosome Location
- 16
- Locus
- 16q13
- External Identifiers
Resource Link UniProtKB ID P25713 UniProtKB Entry Name MT3_HUMAN GeneCard ID MT3 HGNC ID HGNC:7408 PDB ID(s) 2F5H, 2FJ4, 2FJ5 KEGG ID hsa:4504 NCBI Gene ID 4504 - General References
- Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47. [Article]
- Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7. [Article]
- Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50. [Article]
- Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7. [Article]
- Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45. [Article]
- Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [Article]
Associated Data
- Drug Relations
Drug Drug group Pharmacological action? Type Actions Details Zinc approved, investigational unknown target Details Zinc acetate approved, investigational unknown target Details Zinc chloride approved, investigational unknown target cofactor Details Zinc sulfate, unspecified form approved, experimental unknown target cofactor Details