Search
Aripiprazole
go.drugbank.com/drugs/DB01238ApprovedInvestigational[L45859,A4393] Aripiprazole was given FDA approval on November 15, 2002.[L6136] … [L45859] Aripiprazole exerts its effects through agonism of dopaminergic and 5-HT1A receptors and antagonism of alpha-adrenergic and 5-HT2A receptors.
Categories: Heterocyclic Compounds, 2-Ring, Adrenergic alpha-1 Receptor AntagonistsProducts: ARIP MT 10 TABLETS 10mg, ARIP MT 15 TABLETS 15mgTramadol
go.drugbank.com/drugs/DB00193ApprovedInvestigationalIt is considered a Step 2 option on the World Health Organization's pain ladder and has about 1/10th of the potency of [morphine]. … into active metabolites: (+)-tramadol and its primary metabolite (+)-O-desmethyl-tramadol (M1) are agonists of the μ opioid receptor while (+)-tramadol inhibits serotonin reuptake and (-)-tramadol inhibits
Mixtures: ZALDIAR 37,5 MG/325 MG FİLM KAPLI TABLET, 10 ADET, ZALDIAR 37,5 MG/325 MG FİLM KAPLI TABLET, 20 ADETCategories: Serotonin 5-HT2 Receptor Antagonists, Serotonin 5-HT2C Receptor AntagonistsZavegepant
go.drugbank.com/drugs/DB15688ApprovedInvestigationalof oral zavegepant (150 mg bid) in subjects with mild allergic asthma. … [L45505] CGRP is released from sensory nerves and acts as a strong vasodilator, and thanks to these properties, it is involved in pain pathways.
Synonyms: 1-piperidinecarboxamide, 4-(1,2-dihydro-2-oxo-3-quinolinyl)-n-((1r)-1-((7-methyl-1h-indazol-5-yl)methyl)-2-(4-(1-methyl-4-piperidinyl)-1-piperazinyl)-2-oxoethyl)-Categories: Heterocyclic Compounds, 2-Ring, MATE 1 SubstratesRabeprazole
go.drugbank.com/drugs/DB01129ApprovedInvestigationalIt is a prodrug - in the acid environment of the parietal cells it turns into active sulphenamide form. … Rabeprazole inhibits the H+, K+ATPase of the coating gastric cells and dose-dependent oppresses basal and stimulated gastric acid secretion.
Mixtures: RABEDIC 10/75 MG MR KAPSÜL, 20 ADET, RABEDIC 10/75 MG MR KAPSÜL, 30 ADETCategories: Heterocyclic Compounds, 1-Ring, 2-PyridinylmethylsulfinylbenzimidazolesAcetaminophen
go.drugbank.com/drugs/DB00316ApprovedInvestigational[L5786,L5789,L4396] On September 22, 2025, the US FDA initiated a labeling change for acetaminophen products suggesting that the use of acetaminophen by pregnant women may be associated with an increased … first-line therapeutic option when used at the lowest effective dose for the shortest required duration.
Synonyms: N-acetyl-p-aminophenol, 4-acetamidophenolInternational brands: St. Joseph Fever Reducer, Dapa X-SKetoprofen
go.drugbank.com/drugs/DB01009ApprovedInvestigationalVet approvedKetoprofen, a propionic acid derivative, is a nonsteroidal anti-inflammatory agent (NSAIA) with analgesic and antipyretic properties.
Synonyms: m-Benzoylhydratropic acid, 2-(3-Benzoylphenyl)propionic acidInternational brands: Orudis KTE1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the SMN2 gene which is under investigation for the treatment of spinal muscular atrophy (SMA).
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')Pyridoxine phosphate
go.drugbank.com/drugs/DB02209InvestigationalSynonyms: Pyridoxine 5-phosphateCategories: Heterocyclic Compounds, 1-Ring, Vitamin B ComplexZamaporvint
go.drugbank.com/drugs/DB18765InvestigationalSynonyms: 1h-imidazole-1-acetamide, 5-methyl-n-(5-(2-pyrazinyl)-2-pyridinyl)-4-(2-(trifluoromethyl)-4-pyridinyl)-, 5-methyl-n-(5-(2-pyrazinyl)-2-pyridinyl)-4-(2-(trifluoromethyl)-4-pyridinyl)-1h-imidazole-1-acetamideLacosamide
go.drugbank.com/drugs/DB06218ApprovedInvestigationalAs a chiral functionalized amino acid, it works by blocking slowly inactivating components of voltage-gated sodium currents. … Lacosamide exhibits a stereoselective mode of interaction with sodium channels.
Mixtures: ELEPSİ 50 MG+100 MG TEDAVİYE BAŞLAMA PAKETİ, 42 ADET, ELEPSİ 50 MG+100 MG TEDAVİYE BAŞLAMA PAKETİ, 42 ADETCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A Substrates