E1v1.11
Star0
Identification
- Generic Name
- E1v1.11
- DrugBank Accession Number
- DB18363
- Background
E1v1.11 is an antisense oligonucleotide targeting the SMN2 gene which is under investigation for the treatment of spinal muscular atrophy (SMA).1
- Type
- Biotech
- Groups
- Investigational
- Biologic Classification
- Gene Therapies
Antisense oligonucleotides - Synonyms
- Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')
Pharmacology
- Indication
Not Available
Reduce drug development failure ratesBuild, train, & validate machine-learning modelswith evidence-based and structured datasets.Build, train, & validate predictive machine-learning models with structured datasets.- Contraindications & Blackbox Warnings
- Prevent Adverse Drug Events TodayTap into our Clinical API for life-saving information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.Avoid life-threatening adverse drug events with our Clinical API
- Pharmacodynamics
Not Available
- Mechanism of action
- Not Available
- Absorption
Not Available
- Volume of distribution
Not Available
- Protein binding
Not Available
- Metabolism
- Not Available
- Route of elimination
Not Available
- Half-life
Not Available
- Clearance
Not Available
- Adverse Effects
- Improve decision support & research outcomesWith structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates. View sample adverse effects data in our new Data Library!Improve decision support & research outcomes with our structured adverse effects data.
- Toxicity
Not Available
- Pathways
- Not Available
- Pharmacogenomic Effects/ADRs
- Not Available
Interactions
- Drug Interactions
- This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.Not Available
- Food Interactions
- Not Available
Categories
- Drug Categories
- Not Available
- Classification
- Not classified
- Affected organisms
- Not Available
Chemical Identifiers
- UNII
- Not Available
- CAS number
- Not Available
References
- General References
- SMA News Today: FDA Grants Shift’s E1v1.11 Orphan Drug Status for SMA [Link]
- External Links
- Not Available
Clinical Trials
Pharmacoeconomics
- Manufacturers
- Not Available
- Packagers
- Not Available
- Dosage Forms
- Not Available
- Prices
- Not Available
- Patents
- Not Available
Properties
- State
- Not Available
- Experimental Properties
- Not Available
Drug created at September 20, 2023 14:52 / Updated at September 21, 2023 13:10