Search
Tribulus terrestris fruit
go.drugbank.com/drugs/DB14305InvestigationalTribulus terrestris fruit is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Synonyms: Bai Ji LiIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3', DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T)Rilonacept
go.drugbank.com/drugs/DB06372ApprovedInvestigationalRilonacept functions as an interleukin 1 inhibitor and is used in the treatment of CAPS, also known as cryopyrin-associated periodic syndromes, including familial cold auto-inflammatory syndrome (FCAS)
Interferon alfacon-1
go.drugbank.com/drugs/DB00069ApprovedWithdrawnInterferon alfacon-1 differs from interferon alfa-2b at 20/166 amino acids (88% homology), and comparison with interferon-beta shows identity at over 30% of the amino acid positions. … This protein has a molecular weight of 19,434 daltons.
Categories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 Enzyme InhibitorsThioproperazine
go.drugbank.com/drugs/DB01622ApprovedIt is virtually without antiserotonin and hypotensive action and has no antihistaminic property. … Thioproperazine has a marked cataleptic and antiapomorphine activity associated with relatively slight sedative, hypothermic and spasmolytic effects.
Categories: Serotonin 5-HT1 Receptor Antagonists, Serotonin 5-HT2 Receptor AntagonistsSynonyms: N,N-Dimethyl-10-[3-(4-methyl-1-piperazinyl)propyl]-10H-phenothiazine-2-sulfonamide, 2-dimethylsulfamido-(10-(3-1-methylpiperazinyl-4)propyl)-phenothiazinersPSMA Vaccine
go.drugbank.com/drugs/DB06361ApprovedWithdrawnrsPSMA Vaccine is a subunit vaccine based on a novel rsPSMA protein that represents the entire extracellular domain of PSMA (Schulke et al., PNAS 100:12590, 2003). … Prostate-specific membrane antigen (PSMA) is an ∼100 kDa transmembrane glycoprotein that is abundantly and preferentially expressed in prostate cancer, including recurrent and hormone-refractory cases.
Me-4(18F)DG
go.drugbank.com/drugs/DB19207InvestigationalMe-4(18F)DG is under investigation in clinical trial NCT05558904 (An Investigational Scan (Me-4fdg PET/CT) for the Detection of Sodium-glucose Transport for Early Diagnosis of Lung Cancer).
Synonyms: (2s,3r,4r,5s,6r)-5-(fluoro-18f)-6-(hydroxymethyl)-2-methoxytetrahydro-2h-pyran-3,4-diolPiperonyl butoxide
go.drugbank.com/drugs/DB09350ApprovedVet approvedIt has no pesticidal activity of its own, but acts to increase the activity of pesticides such as carbamates, pyrethrins, pyrethroids, and rotenone. … Piperonyl butoxide (PBO) is an organic compound used as a component of pesticide formulations. It is used for the treatment of head, pubic (crab), and body lice. Piperonyl butoxide is a synergist.
Mixtures: KWELL-P %0,3 + %3 MEDİKAL ŞAMPUAN, 120 ML, KWELL-P %0,3 + %3 MEDİKAL ŞAMPUAN, 60 MLCategories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 CYP3A InhibitorsLusutrombopag
go.drugbank.com/drugs/DB13125ApprovedInvestigationalx 10^9/L were administered lusutrombopag orally [L4166]. … In two randomized, double-blind, placebo-controlled trials, patients with chronic liver disease and severe thrombocytopenia who were undergoing an invasive procedure with a platelet count less than 50
Halometasone
go.drugbank.com/drugs/DB13728InvestigationalCategories: Cytochrome P-450 CYP3A Inducers, Cytochrome P-450 CYP3A4 InducersProducts: SİCORTEN 0.5MG/G KREM, 10 G, SİCORTEN 0.5MG/G KREM, 30 G