Search
Abaloparatide
go.drugbank.com/drugs/DB05084ApprovedInvestigationalAbaloparatide is an N-terminal analog of parathyroid hormone-related protein (PTHrP) [A256778] and an agonist at the parathyroid hormone type 1 (PTH1) receptor. … [L740] It is a synthetic 34 amino acid peptide with 41% homology to human parathyroid hormone 1-34 and human PTHrP 1-34.
Glutathione
go.drugbank.com/drugs/DB00143ApprovedInvestigationalNutraceuticalA tripeptide with many roles in cells. … It conjugates to drugs to make them more soluble for excretion, is a cofactor for some enzymes, is involved in protein disulfide bond rearrangement and reduces peroxides.
Mixtures: VitaHealth L-Glutathione Plus, Essential Pro ALPHA-G Q10 CapsuleSynonyms: 5-L-Glutamyl-L-cysteinylglycine, N-(N-gamma-L-Glutamyl-L-cysteinyl)glycineLorlatinib
go.drugbank.com/drugs/DB12130ApprovedInvestigationalLorlatinib is a third-generation ALK tyrosine kinase inhibitor (TKI) for patients with ALK-positive metastatic non-small cell lung cancer[L39905] which was first approved by the US FDA in November of 2018 … approved by the EMA in 2019 for the treatment of select patients with previously treated advanced ALK-positive non-small cell lung cancer, followed by an expanded approval in 2022 to include lorlatinib as a
Categories: MATE 1 Inhibitors, P-glycoprotein inducersProducts: LORBRENA® 25 MG, LORBRENA® 100 MGNuclear factor NF-kappa-B complex
go.drugbank.com/bio_entities/BE0009554TargetHumansBesides its activity as a direct transcriptional activator, it is also able to modulate promoters accessibility to transcription factors and thereby indirectly regulate gene expression. … Essential for cytokine gene expression in T-cells (PubMed:15790681). The NF-kappa-B homodimeric RELA-RELA complex appears to be involved in invasin-mediated activation of IL-8 expression.
Synonyms: Nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1HT-0712
go.drugbank.com/drugs/DB11650InvestigationalBLX-028914 has been used in trials studying the treatment and basic science of Allergic Rhinitis and Age-Associated Memory Impairment (AAMI).
Categories: Heterocyclic Compounds, 1-RingDactolisib
go.drugbank.com/drugs/DB11651InvestigationalDactolisib has been used in trials studying the treatment of Cancer, Solid Tumor, Renal Cancer, Breast Cancer, and Cowden Syndrome, among others.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingFigitumumab
go.drugbank.com/drugs/DB11685InvestigationalFigitumumab has been used in trials studying the treatment of Sarcoma, Solid Tumor, Breast Cancer, Lung Neoplasms, and Advanced Cancer, among others.
Antineoplaston A10
go.drugbank.com/drugs/DB11702InvestigationalAntineoplaston A10 has been used in trials studying the treatment of Sarcoma, Lymphoma, Lung Cancer, Liver Cancer, and Kidney Cancer, among others.
Categories: Heterocyclic Compounds, 1-RingSynonyms: BENZENEACETAMIDE, N-(2,6-DIOXO-3-PIPERIDINYL)-, (S)-, BENZENEACETAMIDE, N-((3S)-2,6-DIOXO-3-PIPERIDINYL)-E1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the _SMN2_ gene which is under investigation for the treatment of spinal muscular atrophy (SMA).[L48196]
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')Naptumomab estafenatox
go.drugbank.com/drugs/DB12807InvestigationalNaptumomab Estafenatox has been used in trials studying the treatment of Pancreatic Cancer, Renal Cell Carcinoma, and Non-Small-Cell Lung Carcinoma.