Search
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Neutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain. … Neutramycin has a monoisotopic molecular weight of 686.35 Da.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-Narasin
go.drugbank.com/drugs/DB11432ExperimentalVet approvedNarasin is an agent with coccidiostatic and antibacterial properties.
Categories: Heterocyclic Compounds, 1-RingSynonyms: Narasin ATanshinone I
go.drugbank.com/drugs/DB16886ExperimentalCategories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 CYP2C9 InhibitorsSynonyms: Tanshinone A, Tanshinon I(5-BROMO-4-CHLORO-3-INDOLYL)-A-D-MANNOSE
go.drugbank.com/drugs/DB04806ExperimentalSynonyms: (5-BROMO-4-CHLORO-3-INDOLYL)-A-D-MANNOSEN,N'-DIPHENYLPYRAZOLO[1,5-A][1,3,5]TRIAZINE-2,4-DIAMINE
go.drugbank.com/drugs/DB08340ExperimentalSynonyms: N,N'-DIPHENYLPYRAZOLO[1,5-A][1,3,5]TRIAZINE-2,4-DIAMINEAllylestrenol
go.drugbank.com/drugs/DB01431InvestigationalA synthetic steroid with progestational activity. … notably not in the United States or Canada.
Categories: Estranes, Cytochrome P-450 SubstratesSynonyms: 17α-allylestr-4-en-17β-ol, 3-deketo-17α-allyl-19-nortestosteroneMethyl-1-testosterone
go.drugbank.com/drugs/DB01572ExperimentalIllicitIt is a derivative of 1-testosterone with a methyl group in the carbon 17. Methyl-1-testosterone is considered a prohibited doping substance. … Methyl-1-testosterone is a synthetic and orally active anabolic–androgenic steroid (AAS) which was never marketed for medical use.
Synonyms: (5α,17β)-17-Hydroxy-17-methylandrost-1-en-3-one, 17alpha-Methyl-17beta-hydroxy-5alpha-androst-1-en-3-oneRevakinagene taroretcel
go.drugbank.com/drugs/DB05344ApprovedInvestigational(rhCNTF) (NTC-201-6A cell line) for surgical intravitreal placement. … [A265115] On March 6, 2025, FDA approved revakinagene taroretcel for the treatment of idiopathic macular telangiectasia type 2.
Synonyms: An allogeneic human adult retinal pigment epithelial (RPE) cell line stably transfected with a plasmid, Allogeneic human adult retinal pigment epithelial (RPE) cell line stably transfected with a plasmid encoding human ciliary neurotrophic factor (CNTF).Pyruvic acid
go.drugbank.com/drugs/DB00119ApprovedInvestigationalNutraceuticalAn intermediate compound in the metabolism of carbohydrates, proteins, and fats. In thiamine deficiency, its oxidation is retarded and it accumulates in the tissues, especially in nervous structures. … (From Stedman, 26th ed)
Synonyms: a-Ketopropionic acid, 2-Oxopropansäure