Search
Daclatasvir
go.drugbank.com/drugs/DB09102ApprovedInvestigationalWithdrawn3 patients. … Daclatasvir is a direct-acting antiviral agent against Hepatitis C Virus (HCV) used for the treatment of chronic HCV genotype 1 and 3 infection.
Categories: P-glycoprotein inhibitors, P-glycoprotein substratesProducts: DAKLINZA 30 MG FILM KAPLI TABLET ,FILM KAPLI TABLET, 28 ADET, I-HEP CLASTAVIR 30Cilazapril
go.drugbank.com/drugs/DB01340ApprovedInvestigationalIt is a prodrug that is hydrolyzed after absorption to its main metabolite cilazaprilat. … It is branded as Inhibace in Canada and other countries, Vascace and Dynorm in a number of European countries, among many other names. None of these varieties are available in the United States.
Mixtures: ACEPRIX PLUS 5 MG/12.5 MG FILM TABLET, 30 ADET, INHIBACE PLUS 5 MG TABLET, 28 ADETCategories: P-glycoprotein inhibitors, Heterocyclic Compounds, 1-RingVirulizin
go.drugbank.com/drugs/DB17098InvestigationalSynonyms: Virulizin-2.gamma., Bos taurus bile extract (heat hydrolyzed; mw < 3000)Reveglucosidase alfa
go.drugbank.com/drugs/DB17665InvestigationalSynonyms: Des-(2-7)-human insulin-like growth factor ii fusion protein with glycyl-l-alanyl-l-prolyl-human lysosomal alpha-glucosidase (acid maltase, aglucosidase alfa) produced in chinese hamster ovary (cho) cellsDihydrouridine
go.drugbank.com/drugs/DB17822ExperimentalSynonyms: 1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,3-diazinane-2,4-dione, 2,4(1h,3h)-pyrimidinedione, dihydro-1-.beta.-d-ribofuranosyl-Categories: Heterocyclic Compounds, 1-RingTopiramate
go.drugbank.com/drugs/DB00273ApprovedInvestigational[L10550] Characteristics that distinguish topiramate from other antiepileptic drugs are a monosaccharide chemical structure containing a sulfamate, and 40% of its mass accounted for by oxygen. … Topiramate is a anti-epileptic drug used to manage seizures and prevent migraines.[A175249] It was initially approved by the FDA in 1996.
Categories: P-glycoprotein substrates, Cytochrome P-450 CYP3A InducersSynonyms: 2,3:4,5-bis-O-(1-methylethylidene)-β-D-fructopyranose sulfamate, 2,3:4,5-di-O-isopropylidene-β-D-fructopyranose sulfamateIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Azilsartan medoxomil
go.drugbank.com/drugs/DB08822ApprovedInvestigationalIt is also available in a combination product with [chlorthalidone]. … It is a selective AT1 subtype angiotensin II receptor antagonist. Azilsartan medoxomil is a relatively recently-developed antihypertensive drug that was first approved by the FDA in February 2011.
Mixtures: EDARBI CLD®, EDARBYCLOR (TABLETS) 40 MG/12.5 MGCategories: Angiotensin 2 Receptor Blocker, Heterocyclic Compounds, 2-RingVenlafaxine
go.drugbank.com/drugs/DB00285ApprovedInvestigationalVenlafaxine is an antidepressant and a serotonin and norepinephrine reuptake inhibitor (SNRI). … It was also considered a second-line treatment for obsessive-compulsive disorder (OCD).
Categories: P-glycoprotein inhibitors, P-glycoprotein substratesProducts: VENOXOR®75 MG, EFEXOR® XR 37.5 MG CAPSULASEstriol
go.drugbank.com/drugs/DB04573ApprovedInvestigationalVet approvedA hydroxylated metabolite of estradiol or estrone that has a hydroxyl group at C3-beta, 16-alpha, and 17-beta position. Estriol is a major urinary estrogen. … It has also been approved and marketed throughout Europe and Asia for approximately 40 years for the treatment of post-menopausal hot flashes.
Mixtures: GYNOFLOR 50 MG/0.03 MG VAJİNAL TABLET, 6 ADET, GYNOFLOR 50 MG/0.03 MG VAJİNAL TABLET, 12 ADETCategories: P-glycoprotein inducers, P-glycoprotein substrates