Search
Apadoline
go.drugbank.com/drugs/DB20043ExperimentalApadoline is a small molecule drug. The usage of the INN stem '-adol/-adol-' in the name indicates that Apadoline is a analgesic. Apadoline has a monoisotopic molecular weight of 395.2 Da.
Categories: Heterocyclic Compounds, 3-RingEdronocaine
go.drugbank.com/drugs/DB20130ExperimentalEdronocaine is a small molecule drug. The usage of the INN stem '-caine' in the name indicates that Edronocaine is a local anaesthetic. Edronocaine has a monoisotopic molecular weight of 251.19 Da.
Erizepine
go.drugbank.com/drugs/DB20234ExperimentalErizepine is a small molecule drug. The usage of the INN stem '-zepine' in the name indicates that Erizepine is a tricyclic compound. Erizepine has a monoisotopic molecular weight of 290.18 Da.
Tigemonam
go.drugbank.com/drugs/DB20272ExperimentalTigemonam is a small molecule drug. The usage of the INN stem '-monam' in the name indicates that Tigemonam is a monobactam antibiotic. Tigemonam has a monoisotopic molecular weight of 437.03 Da.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-RingHydroxytetracaine
go.drugbank.com/drugs/DB20319ExperimentalHydroxytetracaine is a small molecule drug. The usage of the INN stem '-caine' in the name indicates that Hydroxytetracaine is a local anaesthetic. … Hydroxytetracaine has a monoisotopic molecular weight of 280.18 Da.
Alimadol
go.drugbank.com/drugs/DB20326ExperimentalAlimadol is a small molecule drug. The usage of the INN stem '-adol/-adol-' in the name indicates that Alimadol is a analgesic. Alimadol has a monoisotopic molecular weight of 281.18 Da.
Foselutoclax
go.drugbank.com/drugs/DB21663InvestigationalFoselutoclax is a small molecule drug. The usage of the INN stem '-toclax' in the name indicates that Foselutoclax is a B-cell lymphoma 2 (Bcl-2) inhibitor. … Foselutoclax is under investigation in clinical trial NCT06011798 (Assess the Efficacy and Safety of Repeat Intravitreal Injections of Foselutoclax (UBX1325) in Patients With DME (ASPIRE)).
E1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the _SMN2_ gene which is under investigation for the treatment of spinal muscular atrophy (SMA).[L48196]
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')SPP1148
go.drugbank.com/drugs/DB05203ExperimentalSPP1148, the most promising compound from a new series of renin inhibitors for the treatment of hypertension and related end-organ disease.
Terevalefim
go.drugbank.com/drugs/DB16397InvestigationalTerevalefim is under investigation in clinical trial NCT02474667 (Reduce the Severity of DGF in Recipients of a Deceased Donor Kidney).
Categories: Heterocyclic Compounds, 1-Ring