Search
Cry5B
go.drugbank.com/drugs/DB17783ExperimentalCry5B is a pore-forming crystal protein produced by and derived from the soil bacterium _Bacillus thuringiensis_.
Rivabazumab pegol
go.drugbank.com/drugs/DB17788InvestigationalRivabazumab pegol is being investigated as a treatment of Pseudomonas aeruginosa lung infections in patients with cystic fibrosis.[A259457]
Synonyms: KB001-A, KB001-A (AN ANTI-PCRV PEGYLATED MONOCLONAL ANTIBODY FRAGMENT TO THE TYPE III SECRETION SYSTEM OF PSEUDOMONAS AERUGINOSA)MOR-22
go.drugbank.com/drugs/DB17790ExperimentalMOR-22, a Natural human lymphoblastoid interferon-alpha, is currently being investigated to treat papillomavirus warts in the oral cavity of HIV-positive patients.
INM004
go.drugbank.com/drugs/DB17791InvestigationalINM004, a Neutralizing Equine Anti-Stx Hyperimmune Immunoglobulin F(Ab')2 Fragment, is currently being investigated to treat Shiga-toxin producing bacterial infection relating to the prevention of hemolytic
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'RST-001
go.drugbank.com/drugs/DB17843InvestigationalRST-001 is a non-replicating recombinant adeno-associated virus vector containing a fragment of the gene encoding channel rhodopsin-2 protein.
TAK-754
go.drugbank.com/drugs/DB17850InvestigationalDeveloped by Takeda, it is being investigated for the treatment of hemophilia A.[A259831]
MEDI-491
go.drugbank.com/drugs/DB17859ExperimentalMEDI-491 is a recombinant human parvovirus B19 vaccine composed of the VP1 and VP2 capsid proteins.
GsMtx-4
go.drugbank.com/drugs/DB17861InvestigationalGsMtx-4 is a peptide found in tarantula venom that inhibits mechanosensitive ion channel (MSC) activity.
Bifidobacterium Longum Infantis 35624
go.drugbank.com/drugs/DB17871ExperimentalBifidobacterium Longum Infantis 35624 is a probiotic being investigated for the treatment of gastrointestinal disorders, such as Crohn's disease and irritable bowel syndrome.[A259872, A259877]