

Dapsone is a sulfone drug used to treat acne vulgaris, Hansen's disease, and dermatitis herpetiformis.

Brand Names
Generic Name
DrugBank Accession Number

A sulfone active against a wide range of bacteria but mainly employed for its actions against mycobacterium leprae. Its mechanism of action is probably similar to that of the sulfonamides which involves inhibition of folic acid synthesis in susceptible organisms. It is also used with pyrimethamine in the treatment of malaria. (From Martindale, The Extra Pharmacopoeia, 30th ed, p157-8)

Small Molecule
Approved, Investigational
Average: 248.301
Monoisotopic: 248.061948328
Chemical Formula
  • 1,1'-sulfonylbis(4-aminobenzene)
  • 1,1'-Sulfonylbis[4-aminobenzene]
  • 4-(4-amino-benzenesulfonyl)-phenylamine
  • 4-(4-aminophenylsulfonyl)aniline
  • 4-(4-aminophenylsulfonyl)benzenamine
  • 4-aminophenyl sulfone
  • 4,4'-dapsone
  • 4,4'-diaminodiphenyl sulfone
  • 4,4'-Diaminodiphenyl sulphone
  • 4,4'-Diaminodiphenylsulfone
  • 4,4'-sulfonylbisaniline
  • 4,4'-Sulfonylbisbenzenamine
  • 4,4'-Sulfonylbisbenzeneamine
  • 4,4'-Sulfonyldianilin
  • 4,4'-sulfonyldianiline
  • bis(4-aminophenyl)sulfone
  • Bis(p-aminophenyl) sulfone
  • Dapsona
  • Dapsone
  • Dapsonum
  • DDS
  • Diaphenylsulfone
  • p-aminophenyl sulfone
  • p,p-sulphonylbisbenzamine
  • p,p-sulphonylbisbenzenamine
  • p,p'-diaminodiphenyl sulfone
External IDs
  • NSC-6091



For the treatment and management of leprosy and dermatitis herpetiformis.

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Conditions
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Dapsone is a sulfone with anti-inflammatory immunosuppressive properties as well as antibacterial and antibiotic properties. Dapsone is the principal drug in a multidrug regimen recommended by the World Health Organization for the treatment of leprosy. As an anti-infective agent, it is also used for treating malaria and, recently, for Pneumocystic carinii pneumonia in AIDS patients. Dapsone is absorbed rapidly and nearly completely from the gastrointestinal tract. Dapsone is distributed throughout total body water and is present in all tissues. However, it tends to be retained in skin and muscle and especially in the liver and kidney: traces of the drug are present in these organs up to 3 weeks after therapy cessation.

Mechanism of action

Dapsone acts against bacteria and protozoa in the same way as sulphonamides, that is by inhibiting the synthesis of dihydrofolic acid through competition with para-amino-benzoate for the active site of dihydropteroate synthetase. The anti-inflammatory action of the drug is unrelated to its antibacterial action and is still not fully understood.

AInactive dihydropteroate synthase 2
Mycobacterium leprae (strain TN)
ADihydropteroate synthase 1
Mycobacterium leprae (strain TN)

Bioavailability is 70 to 80% following oral administration.

Volume of distribution

Not Available

Protein binding

70 to 90%


Hepatic, mostly CYP2E1-mediated.

Hover over products below to view reaction partners

Route of elimination



28 hours (range 10-50 hours)


Not Available

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

Overdosage might be expected to produce nasal congestion, syncope, or hallucinations. Measures to support blood pressure should be taken if necessary.

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredRisk of mild hemolysis and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredRisk of mild hemolysis and hemolytic anemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AbametapirThe serum concentration of Dapsone can be increased when it is combined with Abametapir.
AbataceptThe metabolism of Dapsone can be increased when combined with Abatacept.
AbirateroneThe metabolism of Dapsone can be decreased when combined with Abiraterone.
AbrocitinibThe metabolism of Abrocitinib can be decreased when combined with Dapsone.
AcalabrutinibThe metabolism of Dapsone can be decreased when combined with Acalabrutinib.
AcenocoumarolThe metabolism of Acenocoumarol can be increased when combined with Dapsone.
AcetaminophenThe risk or severity of methemoglobinemia can be increased when Dapsone is combined with Acetaminophen.
AcetazolamideThe therapeutic efficacy of Dapsone can be increased when used in combination with Acetazolamide.
AcetohexamideThe metabolism of Acetohexamide can be decreased when combined with Dapsone.
AcetophenazineThe risk or severity of QTc prolongation can be increased when Dapsone is combined with Acetophenazine.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
  • Take with or without food. The absorption is unaffected by food.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Product Images
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
AczoneGel50 mg/1gTopicalQlt Inc.2007-09-04Not applicableUS flag
AczoneGel50 mg/1gTopicalAllergan, Inc.2009-06-24Not applicableUS flag
AczoneGel5 % w/wTopicalBausch Health, Canada Inc.2011-10-21Not applicableCanada flag
AczoneGel75 mg/1gTopicalAlmirall, LLC2019-09-10Not applicableUS flag
AczoneGel50 mg/1gTopicalAlmirall, LLC2022-02-12Not applicableUS flag
Aczone 7.5Gel75 mg/1gTopicalAllergan, Inc.2016-02-26Not applicableUS flag
Avlosulfon Tab 100mgTablet100 mgOralAyerst Laboratories1971-12-311996-09-10Canada flag
DapsoneGel50 mg/1gTopicalPacific Pharma, Inc.2017-10-18Not applicableUS flag
DapsoneTablet100 mgOralJacobus Pharmaceutical Company, Inc.1994-12-31Not applicableCanada flag
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
DapsoneTablet100 mg/1OralANI Pharmaceuticals, Inc.2018-01-15Not applicableUS flag
DapsoneTablet25 mg/1OralNostrum Laboratories, Inc.2016-05-09Not applicableUS flag
DapsoneTablet25 mg/1OralAv Kare, Inc.2017-05-17Not applicableUS flag
DapsoneTablet25 mg/1OralTaro Pharmaceuticals U.S.A., Inc.2019-03-01Not applicableUS flag
DapsoneGel75 mg/1gTopicalTaro Pharmaceuticals U.S.A., Inc.2020-01-01Not applicableUS flag
DapsoneTablet25 mg/1OralCarilion Materials Management2016-03-04Not applicableUS flag
DapsoneTablet100 mg/1OralRemedy Repack2010-11-182011-11-19US flag
DapsoneTablet25 mg/1OralGolden State Medical Supply, Inc.2016-05-06Not applicableUS flag
DapsoneGel75 mg/1gTopicalMylan Pharmaceuticals Inc.2022-05-20Not applicableUS flag
DapsoneGel50 mg/1gTopicalTaro Pharmaceuticals U.S.A., Inc.2017-10-16Not applicableUS flag
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
แลพโปรมิกซ์Dapsone (100 MG) + Rifampicin (600 MG)Kitบริษัท พอนด์ เคมีคอล จำกัด2016-08-312019-10-21Thailand flag
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing EndRegionImage
011503 Dapsone 6% / Niacinamide 2% / Spironolactone 5%Dapsone (6 g/100g) + Nicotinamide (2 g/100g) + Spironolactone (5 g/100g)GelTopicalSincerus Florida, LLC2020-07-02Not applicableUS flag
011504 Dapsone 8.5% / Niacinamide 4%Dapsone (8.5 g/100g) + Nicotinamide (4 g/100g)GelTopicalSincerus Florida, LLC2020-07-02Not applicableUS flag
Dapsone 6% / Niacinamide 2% / Spironolactone 5%Dapsone (6 g/100g) + Nicotinamide (2 g/100g) + Spironolactone (5 g/100g)GelTopicalSincerus Florida, LLC2019-05-11Not applicableUS flag
Dapsone 6% / Niacinamide 2% / Tretinoin 0.025%Dapsone (6 g/100g) + Nicotinamide (2 g/100g) + Tretinoin (0.025 g/100g)GelTopicalSincerus Florida, LLC2019-05-04Not applicableUS flag
Dapsone 6% / Niacinamide 4%Dapsone (6 g/100g) + Nicotinamide (4 g/100g)GelTopicalSincerus Florida, LLC2019-05-01Not applicableUS flag
Dapsone 8.5% / Niacinamide 2% / Spironolactone 5%Dapsone (8.5 g/100g) + Nicotinamide (2 g/100g) + Spironolactone (5 g/100g)GelTopicalSincerus Florida, LLC2019-05-10Not applicableUS flag
Dapsone 8.5% / Niacinamide 2% / Tretinoin 0.025%Dapsone (8.5 g/100g) + Nicotinamide (2 g/100g) + Tretinoin (0.025 g/100g)GelTopicalSincerus Florida LLC2019-05-03Not applicableUS flag
Dapsone 8.5% / Niacinamide 4%Dapsone (8.5 g/100g) + Nicotinamide (4 g/100g)GelTopicalSincerus Florida, LLC2019-05-01Not applicableUS flag


ATC Codes
D10AX05 — DapsoneJ04BA02 — Dapsone
Drug Categories
Chemical TaxonomyProvided by Classyfire
This compound belongs to the class of organic compounds known as benzenesulfonyl compounds. These are aromatic compounds containing a benzenesulfonyl group, which consists of a monocyclic benzene moiety that carries a sulfonyl group.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Benzenesulfonyl compounds
Direct Parent
Benzenesulfonyl compounds
Alternative Parents
Aniline and substituted anilines / Sulfones / Primary amines / Organopnictogen compounds / Organic oxides / Hydrocarbon derivatives
Amine / Aniline or substituted anilines / Aromatic homomonocyclic compound / Benzenesulfonyl group / Hydrocarbon derivative / Organic nitrogen compound / Organic oxide / Organic oxygen compound / Organonitrogen compound / Organopnictogen compound
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
sulfone, substituted aniline (CHEBI:4325)
Affected organisms
  • Mycobacteria
  • Mycobacterium leprae

Chemical Identifiers

CAS number
InChI Key


Synthesis Reference

Weijiard, J.and Messerly, J.P.; U.S. Patent 2,385,899; October 2,1945; assigned to Merck & Co., Inc.

General References
Not Available
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
FDA label
Download (515 KB)
Download (53.5 KB)

Clinical Trials

Clinical Trials
4CompletedTreatmentAcne Vulgaris10
4CompletedTreatmentHansen's Disease1
4CompletedTreatmentHansen's Disease / Obesity / Tuberculosis (TB)1
4CompletedTreatmentMalaria caused by Plasmodium falciparum2
4Not Yet RecruitingTreatmentAcne Vulgaris1
4TerminatedTreatmentBullous dermatitis herpetiformis1
4Unknown StatusTreatmentAcne / Allergic Cutaneous Vasculitis / Bullous Skin Diseases / Hansen's Disease / Pneumocystis Jirovecii Pneumonia / Psoriasis (PsO) / Sterile Pustulosis / Urticaria1
4WithdrawnTreatmentPneumocystis Jirovecii Pneumonia1
3CompletedNot AvailableMalaria caused by plasmodium vivax / Plasmodium Infections1


  • Jacobus pharmaceutical co
  • Allergan Inc.
  • A-S Medication Solutions LLC
  • Comprehensive Consultant Services Inc.
  • Gallipot
  • Jacobus Pharmaceutical Co.
  • Kaiser Foundation Hospital
  • Murfreesboro Pharmaceutical Nursing Supply
  • PD-Rx Pharmaceuticals Inc.
  • Physicians Total Care Inc.
  • Prepak Systems Inc.
  • Remedy Repack
  • Tolmar Inc.
Dosage Forms
GelTopical5 %
GelTopical5 % w/w
GelTopical75 mg/1g
GelTopical50 mg/1g
TabletOral100 mg/1
TabletOral25 mg/1
Tablet, film coatedOral50 mg
GelTopical7.5 g
GelTopical5 g
GelTopical7.5 %
TabletOral100 mg
Unit descriptionCostUnit
Dapsone 30 100 mg tablet Box42.99USD box
Dapsone 30 25 mg tablet Box35.99USD box
Aczone 5% gel5.52USD g
Dapsone powder5.38USD g
Dapsone 100 mg tablet0.86USD tablet
Dapsone 25 mg tablet0.2USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)Region
CA2265461No2004-11-302017-09-10Canada flag
US6060085No2000-05-092016-09-11US flag
US5863560No1999-01-262016-09-11US flag
US6620435No2003-09-162016-09-11US flag
US9161926No2015-10-202033-11-18US flag
US9517219No2016-12-132033-11-18US flag
US11273132No2013-11-182033-11-18US flag


Experimental Properties
melting point (°C)175.5 °CNot Available
water solubility380 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.97HANSCH,C ET AL. (1995)
logS-2.82ADME Research, USCD
pKa2.41PERRIN,DD (1965)
Predicted Properties
Water Solubility0.284 mg/mLALOGPS
pKa (Strongest Basic)2.39Chemaxon
Physiological Charge0Chemaxon
Hydrogen Acceptor Count4Chemaxon
Hydrogen Donor Count2Chemaxon
Polar Surface Area86.18 Å2Chemaxon
Rotatable Bond Count2Chemaxon
Refractivity68.99 m3·mol-1Chemaxon
Polarizability25.05 Å3Chemaxon
Number of Rings2Chemaxon
Rule of FiveYesChemaxon
Ghose FilterYesChemaxon
Veber's RuleNoChemaxon
MDDR-like RuleNoChemaxon
Predicted ADMET Features
Human Intestinal Absorption+0.8476
Blood Brain Barrier+0.9705
Caco-2 permeable+0.5879
P-glycoprotein substrateNon-substrate0.8699
P-glycoprotein inhibitor INon-inhibitor0.9311
P-glycoprotein inhibitor IINon-inhibitor0.9572
Renal organic cation transporterNon-inhibitor0.8739
CYP450 2C9 substrateNon-substrate0.7416
CYP450 2D6 substrateSubstrate0.86
CYP450 3A4 substrateNon-substrate0.7175
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorNon-inhibitor0.8955
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorInhibitor0.6127
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.556
Ames testNon AMES toxic0.9132
BiodegradationNot ready biodegradable0.9778
Rat acute toxicity2.3635 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9859
hERG inhibition (predictor II)Non-inhibitor0.864
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (9.27 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Mass Spectrum (Electron Ionization)MSsplash10-052g-8930000000-c51783649020dadfb20f
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QQ , negativeLC-MS/MSsplash10-0002-0190000000-7de0f1aeb77cf9b122f5
LC-MS/MS Spectrum - LC-ESI-QQ , negativeLC-MS/MSsplash10-0002-0290000000-f1e61c46f1720875a177
LC-MS/MS Spectrum - LC-ESI-QQ , negativeLC-MS/MSsplash10-0a4i-0920000000-ed66532a51b7d047462a
LC-MS/MS Spectrum - LC-ESI-QQ , negativeLC-MS/MSsplash10-0a4l-3900000000-a1f636a2e557bc9b69a5
LC-MS/MS Spectrum - LC-ESI-QQ , negativeLC-MS/MSsplash10-052f-9800000000-3557ad8246dc0a0aa05c
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-5910000000-0c8eb03605a271970f1d
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-052b-0590000000-a23b099ad5d2d3cd716d
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-0a4i-1920000000-0260de715fec538fe8bb
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-0a4l-5900000000-6ba41fa3598abafdb242
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-052f-9600000000-d2fe4c5ba425499ba98c
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-052f-9400000000-e29e2bdac763fc5e250b
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-066u-9200000000-71494cee2792628e6a0c
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-014i-9000000000-38433ad894a5e08f6ee0
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-014i-9000000000-e4782e47ceb05d1ffbda
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-014i-9000000000-4ab9019e60b1718d1d29
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0002-0190000000-d7cf0928be57fafd7ea4
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0a4i-1930000000-09cf0e392eeef139f2b1
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0a4l-8900000000-5da3a6d058cb14fc8300
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-052f-9500000000-caa724a9dddce38f915b
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-05mo-9200000000-dc177a76811dcf904424
LC-MS/MS Spectrum - LC-ESI-IT , positiveLC-MS/MSsplash10-0a4i-0900000000-b8af4ee792a585775315
MS/MS Spectrum - , positiveLC-MS/MSsplash10-052b-1890000000-6210a606dbc1cafdcb2a
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-5901100000-901603cf86087b4a4abb
1H NMR Spectrum1D NMRNot Applicable
13C NMR Spectrum1D NMRNot Applicable


Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock new
insights and accelerate drug research.
Learn more
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
Learn more
Mycobacterium leprae (strain TN)
Pharmacological action
General Function
Has very low affinity for the DHPS substrate 6-hydroxymethyl-7,8-dihydropterin-pyrophosphate, but can bind the inhibitor dapsone. Seems to lack dihydropteroate synthase activity, and does probably not function in folate metabolism (By similarity).
Specific Function
Dihydropteroate synthase activity
Gene Name
Uniprot ID
Uniprot Name
Inactive dihydropteroate synthase 2
Molecular Weight
30850.89 Da
  1. Gillis TP, Williams DL: Dapsone resistance does not appear to be associated with a mutation in the dihydropteroate synthase-2 gene of Mycobacterium leprae. Indian J Lepr. 1999 Jan-Mar;71(1):11-8. [Article]
  2. Williams DL, Spring L, Harris E, Roche P, Gillis TP: Dihydropteroate synthase of Mycobacterium leprae and dapsone resistance. Antimicrob Agents Chemother. 2000 Jun;44(6):1530-7. [Article]
  3. Gengenbacher M, Xu T, Niyomrattanakit P, Spraggon G, Dick T: Biochemical and structural characterization of the putative dihydropteroate synthase ortholog Rv1207 of Mycobacterium tuberculosis. FEMS Microbiol Lett. 2008 Oct;287(1):128-35. doi: 10.1111/j.1574-6968.2008.01302.x. Epub 2008 Aug 1. [Article]
Mycobacterium leprae (strain TN)
Pharmacological action
General Function
Metal ion binding
Specific Function
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate, the immediate precursor of folate derivatives.
Gene Name
Uniprot ID
Uniprot Name
Dihydropteroate synthase
Molecular Weight
29447.355 Da
  1. Cambau E, Carthagena L, Chauffour A, Ji B, Jarlier V: Dihydropteroate synthase mutations in the folP1 gene predict dapsone resistance in relapsed cases of leprosy. Clin Infect Dis. 2006 Jan 15;42(2):238-41. Epub 2005 Dec 12. [Article]
  2. Lee SB, Kim SK, Kang TJ, Chae GT, Chun JH, Shin HK, Kim JP, Ko YH, Kim NH: The prevalence of folP1 mutations associated with clinical resistance to dapsone, in Mycobacterium leprae isolates from South Korea. Ann Trop Med Parasitol. 2001 Jun;95(4):429-32. [Article]
  3. Williams DL, Spring L, Harris E, Roche P, Gillis TP: Dihydropteroate synthase of Mycobacterium leprae and dapsone resistance. Antimicrob Agents Chemother. 2000 Jun;44(6):1530-7. [Article]
  4. Gengenbacher M, Xu T, Niyomrattanakit P, Spraggon G, Dick T: Biochemical and structural characterization of the putative dihydropteroate synthase ortholog Rv1207 of Mycobacterium tuberculosis. FEMS Microbiol Lett. 2008 Oct;287(1):128-35. doi: 10.1111/j.1574-6968.2008.01302.x. Epub 2008 Aug 1. [Article]


Pharmacological action
General Function
Peroxidase activity
Specific Function
Part of the host defense system of polymorphonuclear leukocytes. It is responsible for microbicidal activity against a wide range of organisms. In the stimulated PMN, MPO catalyzes the production o...
Gene Name
Uniprot ID
Uniprot Name
Molecular Weight
83867.71 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C18
Molecular Weight
55710.075 Da
  1. Winter HR, Wang Y, Unadkat JD: CYP2C8/9 mediate dapsone N-hydroxylation at clinical concentrations of dapsone. Drug Metab Dispos. 2000 Aug;28(8):865-8. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
  2. Hutzler JM, Kolwankar D, Hummel MA, Tracy TS: Activation of CYP2C9-mediated metabolism by a series of dapsone analogs: kinetics and structural requirements. Drug Metab Dispos. 2002 Nov;30(11):1194-200. [Article]
  3. Hutzler JM, Hauer MJ, Tracy TS: Dapsone activation of CYP2C9-mediated metabolism: evidence for activation of multiple substrates and a two-site model. Drug Metab Dispos. 2001 Jul;29(7):1029-34. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Metabolizes several precarcinogens, drugs, and solvents to reactive metabolites. Inactivates a number of drugs and xenobiotics and also bioactivates many xenobiotic substrates to their hepatotoxic ...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2E1
Molecular Weight
56848.42 Da
  1. Mitra AK, Thummel KE, Kalhorn TF, Kharasch ED, Unadkat JD, Slattery JT: Metabolism of dapsone to its hydroxylamine by CYP2E1 in vitro and in vivo. Clin Pharmacol Ther. 1995 Nov;58(5):556-66. doi: 10.1016/0009-9236(95)90176-0. [Article]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Ekins S, Bravi G, Wikel JH, Wrighton SA: Three-dimensional-quantitative structure activity relationship analysis of cytochrome P-450 3A4 substrates. J Pharmacol Exp Ther. 1999 Oct;291(1):424-33. [Article]
  2. Mitra AK, Thummel KE, Kalhorn TF, Kharasch ED, Unadkat JD, Slattery JT: Metabolism of dapsone to its hydroxylamine by CYP2E1 in vitro and in vivo. Clin Pharmacol Ther. 1995 Nov;58(5):556-66. doi: 10.1016/0009-9236(95)90176-0. [Article]
  3. Flockhart Table of Drug Interactions [Link]
Pharmacological action
General Function
Trimethylamine monooxygenase activity
Specific Function
Involved in the oxidative metabolism of a variety of xenobiotics such as drugs and pesticides. It N-oxygenates primary aliphatic alkylamines as well as secondary and tertiary amines. Plays an impor...
Gene Name
Uniprot ID
Uniprot Name
Dimethylaniline monooxygenase [N-oxide-forming] 3
Molecular Weight
60032.975 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Prostaglandin-endoperoxide synthase activity
Specific Function
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gas...
Gene Name
Uniprot ID
Uniprot Name
Prostaglandin G/H synthase 1
Molecular Weight
68685.82 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Prostaglandin-endoperoxide synthase activity
Specific Function
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Constitutively expressed in some tissues in physiological conditions, such as the endothelium, kidney and...
Gene Name
Uniprot ID
Uniprot Name
Prostaglandin G/H synthase 2
Molecular Weight
68995.625 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
  2. Gil JP, Gil Berglund E: CYP2C8 and antimalaria drug efficacy. Pharmacogenomics. 2007 Feb;8(2):187-98. doi: 10.2217/14622416.8.2.187. [Article]
  3. Winter HR, Wang Y, Unadkat JD: CYP2C8/9 mediate dapsone N-hydroxylation at clinical concentrations of dapsone. Drug Metab Dispos. 2000 Aug;28(8):865-8. [Article]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. Ganesan S, Sahu R, Walker LA, Tekwani BL: Cytochrome P450-dependent toxicity of dapsone in human erythrocytes. J Appl Toxicol. 2010 Apr;30(3):271-5. doi: 10.1002/jat.1493. [Article]
  2. Abouraya M, Sacco JC, Hayes K, Thomas S, Kitchens CS, Trepanier LA: Dapsone-associated methemoglobinemia in a patient with slow NAT2*5B haplotype and impaired cytochrome b5 reductase activity. J Clin Pharmacol. 2012 Feb;52(2):272-8. doi: 10.1177/0091270010393343. [Article]
Pharmacological action
General Function
Arylamine n-acetyltransferase activity
Specific Function
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivat...
Gene Name
Uniprot ID
Uniprot Name
Arylamine N-acetyltransferase 2
Molecular Weight
33542.235 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [Article]
Pharmacological action
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A5
Molecular Weight
57108.065 Da
  1. Flockhart Table of Drug Interactions [Link]
Pharmacological action
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A7
Molecular Weight
57525.03 Da
  1. Flockhart Table of Drug Interactions [Link]

Drug created at June 13, 2005 13:24 / Updated at January 30, 2023 18:29