RET proto-oncogene
Details
- Name
- RET proto-oncogene
- Synonyms
- Fragment
- Gene Name
- RET
- Organism
- Humans
- Amino acid sequence
>lcl|BSEQ0010772|RET proto-oncogene GEGDVRCRGAASAVAAAAAAARQ
- Number of residues
- 23
- Molecular Weight
- 2129.3
- Theoretical pI
- 8.55
- GO Classification
- Not Available
- General Function
- Not Available
- Specific Function
- Not Available
- Pfam Domain Function
- Not Available
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0002196|73 bp ATGGCGAAGGCGACGTCCGGTGCCGCGGGGCTGCGTCTGCTGTTGCTGCTGCTGCTGCCG CTGCTAGGCAAAG
- Chromosome Location
- Not Available
- Locus
- 10q11.2
- External Identifiers
Resource Link UniProtKB ID O43519 UniProtKB Entry Name O43519_HUMAN GenBank Protein ID 2795880 GenBank Gene ID AF032124 GenAtlas ID RET - General References
- Patrone G, Puliti A, Bocciardi R, Ravazzolo R, Romeo G: Sequence and characterisation of the RET proto-oncogene 5' flanking region: analysis of retinoic acid responsiveness at the transcriptional level. FEBS Lett. 1997 Dec 8;419(1):76-82. [Article]
- Munnes M, Patrone G, Schmitz B, Romeo G, Doerfler W: A 5'-CG-3'-rich region in the promoter of the transcriptionally frequently silenced RET protooncogene lacks methylated cytidine residues. Oncogene. 1998 Nov 19;17(20):2573-83. [Article]