GM-CSF receptor alpha subunit
Details
- Name
- GM-CSF receptor alpha subunit
- Synonyms
- Not Available
- Gene Name
- CSF2RA
- Organism
- Humans
- Amino acid sequence
>lcl|BSEQ0016804|GM-CSF receptor alpha subunit MIWEEFTPEEGKGYREEVLTVKEIT
- Number of residues
- 25
- Molecular Weight
- 3014.39
- Theoretical pI
- 4.04
- GO Classification
- Not Available
- General Function
- Not Available
- Specific Function
- Not Available
- Pfam Domain Function
- Not Available
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0004873|78 bp ATGATCTGGGAGGAATTCACCCCAGAGGAAGGGAAAGGCTACCGCGAAGAGGTCTTGACC GTGAAGGAAATTACCTGA
- Chromosome Location
- Not Available
- Locus
- Xp22.32 and Yp11.3
- External Identifiers
Resource Link UniProtKB ID Q16498 UniProtKB Entry Name Q16498_HUMAN GenBank Gene ID S48539 GenAtlas ID CSF2RA - General References
- Rappold G, Willson TA, Henke A, Gough NM: Arrangement and localization of the human GM-CSF receptor alpha chain gene CSF2RA within the X-Y pseudoautosomal region. Genomics. 1992 Oct;14(2):455-61. [Article]