Search

Displaying results 1441 - 1450 of 10000 in total
  1. Drug

    Mafenide

    go.drugbank.com/drugs/DB06795
    ApprovedVet approvedWithdrawn

    In November 2022, the use of mafenide acetate (powder for 5% topical solution) was withdrawn by the FDA due to an unresolved confirmatory study required to fulfill the accelerated approval requirements … Mafenide is a sulfonamide-type antimicrobial agent used to treat severe burns. It acts by reducing the bacterial population present in the burn tissue and promotes healing of deep burns.

    Synonyms: 4-Homosufanilamide, 4-(aminomethyl)benzenesulfonamide
  2. Drug

    Technetium Tc-99m oxidronate

    go.drugbank.com/drugs/DB09139
    ApprovedWithdrawn

    [L1138] These complexes are formed by the binding of 99mTc to metal atoms of an organic molecule. … [L1137] The radiopharmaceuticals based on technetium-99m are widely used for diagnostic purposes because 99mTc has a versatile chemistry which allows it to produce an extense variety of complexes with

  3. Drug

    Hydroxyzine

    go.drugbank.com/drugs/DB00557
    ApprovedInvestigational

    [L9677] The active metabolite of hydroxyzine, [cetirizine], is also available as an active ingredient in allergic medications, and is responsible for much of its hydroxyzine's antihistaminic effect. … Hydroxyzine is a first-generation histamine H<sub>1</sub>-receptor antagonist of the dephenylmethane and piperazine classes that exhibits sedative, anxiolytic, and antiemetic properties.

    Mixtures: DOLMARAL®Categories: P-glycoprotein substrates, Cytochrome P-450 Substrates
  4. Drug

    Lotilaner

    go.drugbank.com/drugs/DB17992
    ApprovedInvestigationalVet approved

    Lotilaner is an ectoparasiticide that is a member of the isoxazoline family of compounds. … [L47546] Lotilaner has largely been used for veterinary uses as an antiparasitic agent to treat flea and tick infestations in animals.

    Categories: Heterocyclic Compounds, 1-RingSynonyms: 2-thiophenecarboxamide, 5-((5s)-4,5-dihydro-5-(3,4,5-trichlorophenyl)-5-(trifluoromethyl)-3-isoxazolyl)-3-methyl-n-(2-oxo-2-((2,2,2-trifluoroethyl)amino)ethyl)-, 3-methyi-n-(2-oxo-2-((2,2,2-trifluoroethyl)amino)ethyl)-5-((55)-5-(3,4,5-trichlorophenyl)-5-(trifluoromethyl)-4,5-dihydro-1,2-oxazol-3-yl)thiophene-2-carboxamide
  5. Drug

    Pentostatin

    go.drugbank.com/drugs/DB00552
    ApprovedInvestigational

    A potent inhibitor of adenosine deaminase. The drug is effective in the treatment of many lymphoproliferative malignancies, particularly hairy-cell leukemia.

    Categories: Heterocyclic Compounds, 1-Ring, Drugs that are Mainly Renally Excreted with a Narrow Therapeutic Index
  6. Drug

    IMT504

    go.drugbank.com/drugs/DB17792
    Investigational

    IMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]

    Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'
  7. Drug

    Magnesium Aluminum Silicate

    go.drugbank.com/drugs/DB11230
    ApprovedWithdrawn

    It is refined to a powder for use in cosmetic and pharmaceutical applications as an absorbent, anticaking agent, opacifying agent, viscosity-increasing agent, suspending agent, tablet and capsule disintegrant … It also has antacid properties and is used as a component of some over the counter antacid medications.

  8. Drug

    Piclidenoson

    go.drugbank.com/drugs/DB05511
    Investigational

    CF101 is supplied as an oral drug and has an excellent safety profile. … CF 101 (known generically as IB-MECA) is an anti-inflammatory drug for rheumatoid arthritis patients. Its novel mechanism of action relies on antagonism of adenoside A3 receptors.

    Categories: Heterocyclic Compounds, 2-Ring
  9. Drug

    Lacidipine

    go.drugbank.com/drugs/DB09236
    Approved

    Lacidipine is a lipophilic dihydropyridine calcium antagonist with an intrinsically slow onset of activity. … calcium antagonists, thiazide diuretics, atenolol (a beta-blocker) and enalapril (an ACE inhibitor) [A31536].

    Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingProducts: LACIPIL TABLET 4 mg, LACIPIL 4 MG FILM KAPLI TABLET, 14 ADET
  10. Drug

    Piperonyl butoxide

    go.drugbank.com/drugs/DB09350
    ApprovedVet approved

    Piperonyl butoxide (PBO) is an organic compound used as a component of pesticide formulations. It is used for the treatment of head, pubic (crab), and body lice. Piperonyl butoxide is a synergist. … Piperonyl butoxide is a semisynthetic derivative of safrole.

    Mixtures: Lice Enz Aer Shp, R & C Shampoo With ConditionerCategories: Cytochrome P-450 CYP1A2 Inhibitors, Heterocyclic Compounds, 1-Ring