Search
Guaiacol
go.drugbank.com/drugs/DB11359ApprovedGuaiacol is also present in wood smoke, as a product of pyrolysis of lignin. Guaiacol has been found in the urine of patients with neuroblastoma and pheochromocytoma. … Guaiacol is an agent thought to have disinfectant properties and used as an expectorant. Guaiacol is a phenolic natural product first isolated from Guaiac resin and the oxidation of lignin.
Mixtures: NOKTOS ® ADULTOS JARABE.Synonyms: 1-hydroxy-2-methoxybenzene, 2-methoxyl-4-vinylphenolRadotermin
go.drugbank.com/drugs/DB19127InvestigationalRadotermin is under investigation in clinical trial NCT01182337 (A Clinical Trial to Evaluate the Safety, Tolerability and Preliminary Effectiveness of Single Administration Intradiscal Rhgdf-5 for the
Synonyms: Growth differentiation factor 5 (human), homodimer, Recombinant human growth and differentiation factor-5E1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the _SMN2_ gene which is under investigation for the treatment of spinal muscular atrophy (SMA).[L48196]
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')Treprostinil palmitil
go.drugbank.com/drugs/DB18792InvestigationalSynonyms: Acetic acid, 2-(((1r,2r,3as,9as)-2,3,3a,4,9,9a-hexahydro-2-hydroxy-1-((3s)- 3-hydroxyoctyl)-1h-benz(f)inden-5-yl)oxy)-, hexadecyl ester, Hexadecyl 2-(((1r,2r,3as,9as)-2-hydroxy-1-((s)-3-hydroxyoctyl)-2,3,3a,4,9,9a-hexahydro-1h-cyclopenta(b)naphthalen-5-yl)oxy)acetateDazostinag
go.drugbank.com/drugs/DB18889InvestigationalDazostinag is under investigation in clinical trial NCT04420884 (A Study of Dazostinag as Single Agent and Dazostinag in Combination With Pembrolizumab in Adults With Advanced or Metastatic Solid Tumors
Synonyms: 7-Deazainosine, [P(R)]-2′-deoxy-2′-fluoro-5′-O-[(R)-hydroxymercaptophosphinyl]-P-thioadenylyl-(3′→5′)-7-fluoro-, cyclic (2′→5′)-nucleotidePyridoxine phosphate
go.drugbank.com/drugs/DB02209InvestigationalSynonyms: Pyridoxine 5-phosphateCategories: Heterocyclic Compounds, 1-Ring, Vitamin B ComplexZED-1227
go.drugbank.com/drugs/DB19208InvestigationalZED-1227 is under investigation in clinical trial NCT05305599 (Different Doses of ZED1227 vs. Placebo in NAFLD).
Categories: Heterocyclic Compounds, 1-RingSynonyms: Methyl (e,6s)-7-((1-(2-(2-ethylbutylamino)-2-oxo-ethyl)-2-oxo-3-pyridyl)amino)-6-((3-methylimidazole-4-carbonyl)amino)-7-oxo-hept-2-enoate, (2e,6s)-7-((1-(2-((2-ethylbutyl)amino)-2-oxoethyl)-1,2-dihydro-2-oxo-3-pyridinyl)amino)-6-(((1-methyl-1h-imidazol-5-yl)carbonyl)amino)-7-oxo-2-heptenoic acid methyl esterPanax notoginseng root
go.drugbank.com/drugs/DB14304InvestigationalPanax notoginseng root is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Mixtures: GONGFUTOUTANG Tou Tang Powder No. 3Synonyms: Notoginseng Radix Et RhizomaJS-K
go.drugbank.com/drugs/DB17257ExperimentalSynonyms: O2-(2,4-dinitrophenyl) 1-((4-ethoxycarbonyl)piperazin-1-yl)diazen-1-ium-1,2-diolate, 1-piperazinecarboxylic acid, 4-(2-(2,4-dinitrophenoxy)-1-oxidodiazenyl)-, ethyl esterBetazole
go.drugbank.com/drugs/DB00272ApprovedA histamine H2 agonist used clinically to test gastric secretory function.
Categories: Heterocyclic Compounds, 1-RingSynonyms: 2-(1H-pyrazol-5-yl)ethanamine, 1H-pyrazole-3-ethanamine