Search
Brinzolamide
go.drugbank.com/drugs/DB01194Approved[A2051] Brinzolamide was approved by the FDA in 1998 as a standalone product and in 2013 as a combination product with brimonidine tartrate. … [L35310,L35315] In Europe, it was also approved as a combination product with timolol in 2008.[L35320]
Mixtures: BRINZOLAMIDE E TIMOLOLO EG, BRINZOLAMIDE E TIMOLOLO EGCategories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP2A6 SubstratesFosaprepitant
go.drugbank.com/drugs/DB06717ApprovedInvestigationalIt is a prodrug of Aprepitant. It aids in the prevention of acute and delayed nausea and vomiting associated with chemotherapy treatment.
Categories: Substance P/Neurokinin-1 Receptor Antagonist, Neurokinin 1 AntagonistsProducts: APRITANT IV® 150 MG POLVO LIOFILIZADO PARA RECONSTITUIR A SOLUCION INYECTABLE, BRIAN EXDoravirine
go.drugbank.com/drugs/DB12301ApprovedInvestigational[L12729,L4562] Doravirine is available by itself or as a combination product of doravirine (100 mg), lamivudine (300 mg), and tenofovir disoproxil fumarate (300 mg). … Doravirine is an HIV-1 non-nucleoside reverse transcriptase inhibitor (NNRTI) intended to be administered in combination with other antiretroviral medicines.
Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingMolybdenum
go.drugbank.com/drugs/DB11137ApprovedInvestigationalMolybdenum is a chemical element with symbol Mo and atomic number 42. As it is not a naturally occuring free metal on Earth, molybdenum is found only in various oxidation states in minerals. … When complexed with Technetium Tc 99m, molybdenum is used as a radiopharmaceutical agent in diagonistic procedures.
Mixtures: Ribotin-E, Twin Opti PwrFlorilglutamic acid F-18
go.drugbank.com/drugs/DB15041InvestigationalFlorilglutamic acid F-18 is under investigation in clinical trial NCT02370563 (PET Imaging of Intracranial Cancers With 18F-FSPG).
Synonyms: Florilglutamic acid F-18IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Minigastrin
go.drugbank.com/drugs/DB19196InvestigationalMinigastrin is under investigation in clinical trial NCT06155994 (68ga-dota-mgs5 PET/CT in Patients With Advanced Neuroendocrine Tumours).
Synonyms: L-phenylalaninamide, l-leucyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-.alpha.-aspartyl-l-alanyl-l-tyrosylglycyl-l-tryptophyl-l-leucyl-l-.alpha.-aspartyl-Imipenem
go.drugbank.com/drugs/DB01598ApprovedInvestigationalImipenem is a semisynthetic thienamycin that has a wide spectrum of antibacterial activity against gram-negative and gram-positive aerobic and anaerobic bacteria, including many multiresistant strains. … [A15389] Imipenem is commonly used in combination with [cilastatin] and is now available in a triple-drug product with cilastatin and [relebactam] which was recently approved by the FDA.
Mixtures: IMIPENEM/CILASTATINA POLVO PARA RECONSTITUIR A SOLUCIÓN INYECTABLE, IMIPENEM E CILASTATINA SUNCategories: Heterocyclic Compounds, 2-RingBevacizumab zirconium Zr-89
go.drugbank.com/drugs/DB14907InvestigationalBevacizumab zirconium Zr-89 is under investigation in clinical trial NCT01338090 (89Zr-bevacizumab PET Imaging in Patients With Neuroendocrine Tumors).
Categories: Compounds used in a research, industrial, or household settingORM-13070 C-11
go.drugbank.com/drugs/DB15324InvestigationalORM-13070 C-11 is under investigation in clinical trial NCT00735774 (Suitability of 11C-ORM-13070 as a PET Tracer).
Categories: Heterocyclic Compounds, 1-Ring