Search
Tauroursodeoxycholic acid
go.drugbank.com/drugs/DB08834ApprovedInvestigationalWithdrawnTauroursodeoxycholic acid, also known as ursodoxicoltaurine, is a highly hydrophilic tertiary bile acid [A249070] that is produced in humans at a low concentration. … [A249070] It is a taurine conjugate of [ursodeoxycholic acid] [A249065] with comparable therapeutic efficacy and safety,[A249070] but a much higher hydrophilicity.
Products: TAUROLITE 250 MG 100 KAPSULSilodosin
go.drugbank.com/drugs/DB06207ApprovedInvestigationalSilodosin is a selective antagonist of alpha(α)-1 adrenergic receptors that binds to the α<sub>1A</sub> subtype with the highest affinity. α1-adrenergic receptors regulate smooth muscle tone in the bladder … neck, prostate, and prostatic urethra: the α<sub>1A</sub> subtype accounts for approximately 75% of α1-adrenoceptors in the prostate.
Categories: Heterocyclic Compounds, 2-Ring, Peripheral alpha-1 blockersProducts: SİLODOPİN 4 MG KAPSÜL, 30 ADET, SİLODOPİN 8 MG KAPSÜL, 30 ADETLuxeptinib
go.drugbank.com/drugs/DB19179InvestigationalSynonyms: Urea, n-(4-(2,3-dihydro-7-(5-methyl-1h-imidazol-2-yl)-1-oxo-1h-isoindol-4-yl)-3-fluorophenyl)-n'-(2,4,6-trifluorophenyl)-, 32,72,74,76-tetrafluoro-14-methyl-21,23-dihydro-11h-4,6-diaza-2(4,7)-isoindola- 1(2)-imidazola-3(1,4),7(1)-dibenzenaheptaphane-2,35-dioneUrapidil
go.drugbank.com/drugs/DB12661InvestigationalUrapidil has been investigated for the treatment of Hypertension During Pre-Eclampsia.
Categories: Peripheral alpha-1 blockers, Heterocyclic Compounds, 1-RingProducts: UPADİL 50 MG/10 ML IV ENJEKSİYONLUK ÇÖZELTİ, 5 ADET, EBRASEL 50 MG/10 ML I.V. ENJEKSIYONLUK ÇÖZELTI IÇEREN AMPUL, 5 ADETRoflumilast
go.drugbank.com/drugs/DB01656ApprovedInvestigational[L46541] On December 15, 2023, the FDA approved a new topical foam formulation of roflumilast for the treatment of seborrheic dermatitis in patients aged 9 years and older.[L49281] … [A251385] PDE4 is a major cyclic-3',5′-adenosinemonophosphate (cyclic AMP, cAMP)-metabolizing enzyme [L37564] expressed on nearly all immune and pro-inflammatory cells, in addition to structural cells
Categories: Heterocyclic Compounds, 1-Ring, Cytochrome P-450 SubstratesProducts: ROFLUNG 0,5 MG SAŞE ,30 SAŞE, ROFLUNG 0,5 MG SAŞE ,90 SAŞEAzilsartan medoxomil
go.drugbank.com/drugs/DB08822ApprovedInvestigationalIt is used to treat hypertension as monotherapy or in combination with other antihypertensive drugs. It is also available in a combination product with [chlorthalidone]. … It is a selective AT1 subtype angiotensin II receptor antagonist. Azilsartan medoxomil is a relatively recently-developed antihypertensive drug that was first approved by the FDA in February 2011.
Mixtures: EDARBYCLOR (TABLETS) 40 MG/12.5 MG, EDARBYCLOR (TABLETS) 40 MG/12.5 MGCategories: Angiotensin 2 Receptor Blocker, Heterocyclic Compounds, 1-RingOzanimod
go.drugbank.com/drugs/DB12612ApprovedInvestigationalOzanimod is a once-daily sphingosine 1-phosphate receptor modulator for the treatment of relapsing Multiple Sclerosis (MS) and inflammatory bowel disease. … [A189336] In clinical trials, Ozanimod has been shown to be well-tolerated and has resulted in a higher decrease in the rate of MS relapses than with intramuscular [interferon beta-1a], a current standard
Mixtures: ZEPOSIA 7-Day Starter Pack, ZEPOSIA 7-Day Starter PackCategories: Heterocyclic Compounds, 1-Ring, Sphingosine 1-phosphate Receptor ModulatorIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Marstacimab
go.drugbank.com/drugs/DB17725ApprovedInvestigationalMarstacimab is a human monoclonal immunoglobulin G Type 1 (IgG1) antibody produced by Chinese hamster ovary (CHO) cells by recombinant DNA technology. … [L51803] It is a tissue factor pathway inhibitor (TFPI) antagonist, which is an endogenous anticoagulant.
Synonyms: Immunoglobulin g1, anti-(human tissue factor pathway inhibitor) (human monoclonal pf-06741086 .gamma.1-chain), disulfide with human monoclonal pf-06741086 .lambda.-chain, dimerProducts: Hympavzi 150 mg/mL Enjeksiyonluk Çözelti İçeren Kullanıma Hazır Kalem (1 adet)Enzalutamide
go.drugbank.com/drugs/DB08899ApprovedInvestigationalCompared to the average time of 10 to 15 years for a drug to go from pre-clinical to clinical studies, enzalutamide was developed relatively rapidly.[A252667] … [L40639] It is a second-generation antiandrogen agent that the FDA approved on August 31, 2012.
Categories: Heterocyclic Compounds, 1-Ring, P-glycoprotein inhibitorsProducts: XTANDI ® 40 MG, XTANDI® 40 MG