Search
Octrizole
go.drugbank.com/drugs/DB21133ExperimentalOctrizole is a small molecule drug. Octrizole has a monoisotopic molecular weight of 323.2 Da.
Synonyms: Bisoctrizole related compound aMeningococcal polysaccharide vaccine group W-135
go.drugbank.com/drugs/DB13887ApprovedInvestigational*N. meningitidis* is a bacteria that causes endemic and epidemic diseases including meningitis and meningococcemia. … It is subcutaneously administered as an active immunization against the invasive meningococcal disease caused by the serogroup W-135.
Mixtures: Menomune-A/c/y/w-135, Menomune-A/c/y/w-135Synonyms: Neisseria meningitidis group W-135 polysaccharide antigen, A, Meningococcal polysaccharide antigen group W-135Lavender oil
go.drugbank.com/drugs/DB14566ApprovedMixtures: Lacto Bella YCategories: Complex Mixtures2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide-a
go.drugbank.com/drugs/DB15243Investigational2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide-a is under investigation in clinical trial NCT01668823 (Photodynamic Therapy in Treating Patients With Lung Cancer).
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds with 4 or More RingsSynonyms: 2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide-a, 3-PHORBINEPROPANOIC ACID, 14-ETHYL-9-(1-(HEXYLOXY)ETHYL)-4,8,13,18-TETRAMETHYL-20-OXO-, (3S,4S)-9-(N-methyl-L-isoleucine)-cyclosporin A
go.drugbank.com/drugs/DB13068Investigational9-(N-methyl-L-isoleucine)-cyclosporin A (NIM811) has been used in trials studying the treatment of Chronic Hepatitis C Genotype-1 Relapse.
Rosomidnar
go.drugbank.com/drugs/DB17154InvestigationalSynonyms: (3'-5')d(c-a-c-g-c-a-c-g-c-g-c-a-t-c-c-c-c-g-c-c-c-g-t-g)Besigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Categories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsSynonyms: Gomisin a, (+)-gomisin aTretinoin
go.drugbank.com/drugs/DB00755ApprovedInvestigationalNutraceuticalTretinoin, also known as all-trans-retinoic acid (ATRA), is a naturally occurring derivative of [vitamin A] (retinol). … [A257474] It is an oxidation product in the physiological pathway of vitamin A metabolism.
Synonyms: Vitamin A acid, all-trans-Vitamin A acidInternational brands: Stieva-ABakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'