Search
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Aloglutamol
go.drugbank.com/drugs/DB13650InvestigationalAloglutamol is an antacid salt of aluminium, gluconic acid, and tris. Proprietary names include Altris, Pyreses, Tasto and Sabro.
Iomethin I-125
go.drugbank.com/drugs/DB20779ExperimentalIomethin I-125 is a small molecule drug. Iomethin I-125 has a monoisotopic molecular weight of 353.05 Da.
Hyaluronidase
go.drugbank.com/drugs/DB14740ApprovedInvestigationalHyaluronidase is an enzyme used to improve the absorption and dispersion of parenterally administered fluids, drugs, and contrast agents. … [A199026] Early research into hyaluronidase identified it as a "spreading factor" which allowed for increased permeability of the connective tissue.
Products: POLVO LIOFILIZADO PARA RECONSTITUIR A SOLUCION PARA ADMINISTRACIÓN OFTALMICANemolizumab
go.drugbank.com/drugs/DB15252ApprovedInvestigationalNemolizumab is a humanized monoclonal modified immunoglobulin 2 (IgG2) antibody directed against interleukin-31 receptor alpha (IL-31RA),[L51159] which is an endogenous cytokine implicated in the pathophysiology
Synonyms: Immunoglobulin G2, anti-(interleukin 31 receptor A) (human-Mus musculus monoclonal CIM331 γ-chain), disulfide with human-Mus musculus monoclonal CIM331 κ-chain, dimerTaurolidine
go.drugbank.com/drugs/DB12473ApprovedInvestigationalTaurolidine is an antimicrobial used for the prevention of catheter-related infections. It is a derivative of the amino acid [taurine]. … and Antifungal Drugs (LPAD pathway) for the prevention of catheter-related bloodstream infections in a limited and specific patient population.
Collagenase clostridium histolyticum
go.drugbank.com/drugs/DB00048ApprovedInvestigationalCollagenase clostridium histolyticum is an enzyme produced by the bacterium Clostridium histolyticum. … [L14912] On July 6, 2020 a combination of injectable bacterial collagenases was approved by the FDA for the treatment of cellulite in adult women.
Synonyms: Clostridiopeptidase AHydrocodone
go.drugbank.com/drugs/DB00956ApprovedIllicitInvestigationalHydrocodone is a synthetic opioid derivative of codeine.[T116] It is commonly used in combination with [acetaminophen] to control moderate to severe pain. … Hydrocodone's more potent metabolite, [hydromorphone] has also found wide use as an analgesic and is frequently used in cases of severe pain.
Dihydroergocornine
go.drugbank.com/drugs/DB11273Approved[A32962] It is an artificial derivative of the crude extract of ergot and later purified, ergocornine. … [A32965] Dihydroergocornine presents a formula of 9,10 alpha-dihydro-12'-hydroxy-2',5'alpha-bis(1-methylethyl)-ergotaman-3',6',18-trione.
Octasulfur
go.drugbank.com/drugs/DB09353ApprovedSulfur seems to have an antibacterial activity. It has been also used for acne. … Sulfur is a chemical element that is present in all living tissues. The most commonly used form of pharmaceutical sulfur is Octasulfur (S8).
Mixtures: POLY-N OINTMENT, Prascion RAProducts: De La Cruz Sulfur Acne Medication