Search
Siltuximab
go.drugbank.com/drugs/DB09036ApprovedInvestigationalIt is administered as a 1 hour intravenous infusion every 3 weeks. … Siltuximab is a chimeric (human-mouse) monoclonal immunoglobulin G1-kappa antibody produced in a Chinese hamster ovary (CHO) cell line by recombinant DNA technology.
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
NS-398
go.drugbank.com/drugs/DB14060ExperimentalNS-398 is a COX-2 inhibitor. It was developed as part of the mechanistic study of the cyclooxygenases.
MaaT013
go.drugbank.com/drugs/DB18648InvestigationalMaaT013 is an allogeneic fecal microbiota therapy. It is being investigated for the treatment of Graft-Versus-Host Disease.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Incadronic acid
go.drugbank.com/drugs/DB06255ExperimentalIncadronate, or YM-175,[A202769] is a nitrogen containing bisphosphonate. … Along with being investigated to treat hypercalcemia of malignancy,[A202862] it has also been investigated in the treatment of myeloma, leukemia, and other cancers.
Fibrinolysin
go.drugbank.com/drugs/DB05254InvestigationalFibrinolysin and deoxyribonuclease both act as lytic enzymes. The combination is available as ointment containing 1 BU (Biological Unit) Fibrinolysin and 666 BUs desoxyribonuclease per gram. … Fibrinolysin is used as a local healing ointment when combined together with the enzyme deoxyribonuclease I (extracted from bovine pancreas).
Leronlimab
go.drugbank.com/drugs/DB05941InvestigationalLeronlimab, or PRO-140, is a human monoclonal antibody developed by CytoDyn.[L12684] It was first described in the literature in 2001.
BGT-DTDS
go.drugbank.com/drugs/DB18664ExperimentalBGT-DTDS is an investigational gene therapy comprising an adeno-associated viral vector type 2 (AAV2) encoding the human _SLC6A3_ gene. … It is under investigation for the treatment of dopamine transporter deficiency syndrome (DTDS).
Albinterferon Alfa-2B
go.drugbank.com/drugs/DB05396InvestigationalHuman Genome Sciences is developing Albuferon as a potential treatment for chronic hepatitis C. … The drug was under investigation as an alternative to pegylated IFN-α-2a for the treatment of hepatitis C.