Search
Glucagon-like peptide II
go.drugbank.com/drugs/DB12788InvestigationalGlucagon-like peptide II is under investigation for the basic science of Short Bowel Syndrome.
Synonyms: GLP-2Arketamine
go.drugbank.com/drugs/DB19150InvestigationalArketamine is under investigation in clinical trial NCT05414422 (A Randomized, Placebo-controlled, Double-blind Study to Assess Safety and Efficacy of PCN-101 in TRD).
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP2B6 SubstratesSynonyms: Cyclohexanone, 2-(2-chlorophenyl)-2-(methylamino)-, (2r)-, Cyclohexanone, 2-(o-chlorophenyl)-2-(methylamino)-, (+)-Ropidoxuridine
go.drugbank.com/drugs/DB06485InvestigationalRopidoxuridine is a novel, orally available, thymidine analogue and prodrug for IUdR, which demonstrated a survival advantage in Phase II studies in anaplastic astrocytoma, a type of brain tumor.
Categories: Heterocyclic Compounds, 1-RingSynonyms: 1-(2-DEOXY-.BETA.-D-ERYTHRO-PENTOFURANOSYL)-5-IODOPYRIMIDIN-2(1H)-ONE, 5-iodo-2-pyrimidinone-2'-deoxyriboseE1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the SMN2 gene which is under investigation for the treatment of spinal muscular atrophy (SMA).
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')6-Hydroxypropylthymine
go.drugbank.com/drugs/DB04139ExperimentalSynonyms: 6–(3-hydroxypropyl)thymine, 6-HydroxypropylthymineHeptolamide
go.drugbank.com/drugs/DB19896ExperimentalHeptolamide is a small molecule drug. Heptolamide has a monoisotopic molecular weight of 310.14 Da.
Synonyms: 1-cycloheptyl-3-p-tolylsulfonylureaArbutin
go.drugbank.com/drugs/DB11217ApprovedExtracted from the dried leaves of bearberry plant in the genus _Arctostaphylos_ and other plants commonly in the _Ericaceae_ family, arbutin is a beta-D-glucopyranoside of [DB09526]. … It has also been used as an anti-infective for the urinary system as well as a diuretic [F43].
Mixtures: Dr G Whitening REFORMER by EGF, Dr G Whitening FORTIFIER by EGFSynonyms: 4-Hydroxyphenyl-beta-D-glucopyranoside, hydroquinone O-β-D-glucopyranosideMilacemide
go.drugbank.com/drugs/DB19525ExperimentalMilacemide is a small molecule drug. Milacemide has a monoisotopic molecular weight of 144.13 Da.
Synonyms: 2-(pentylamino)acetamide, Acetamide, 2-(pentylamino)-SGS-742
go.drugbank.com/drugs/DB05010InvestigationalSGS-742 has been used in trials studying the treatment of Seizures and Metabolic Disease.
Synonyms: (3-Aminopropyl)(n-butyl)phosphinic acid, 3-Aminopropyl-Butyl Phosphinic AcidCategories: Compounds used in a research, industrial, or household settingbeta-Alanine
go.drugbank.com/drugs/DB03107InvestigationalA rare genetic disorder, hyper-beta-alaninemia, has been reported. … Since neuronal uptake and neuronal receptor sensitivity to beta-alanine have been demonstrated, the compound may be a false transmitter replacing GAMMA-AMINOBUTYRIC ACID.
Synonyms: 3-aminopropanoic acid, 3-aminopropionic acid