Search
AGuIX
go.drugbank.com/drugs/DB18189InvestigationalAGuIX is an investigational brand product consisting of a polysiloxane matrix and gadolinium chelates. … It is under development as a radiosensitizer to be used during radiation treatment of malignant glioma.
IP501
go.drugbank.com/drugs/DB06450ExperimentalIP-501 is an investigational antifibrotic compound being tested for the treatment of alcohol-induced liver disease and chronic hepatitis-C-induced cirrhosis.
Oremepermin alfa
go.drugbank.com/drugs/DB27148InvestigationalOremepermin alfa is a recombinant human hepatocyte growth factor (isoform 3) and glycoprotein composed of an α-chain and a β-chain.[L54006] It is produced in CHO cells.[L54006]
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
NS-398
go.drugbank.com/drugs/DB14060ExperimentalNS-398 is a COX-2 inhibitor. It was developed as part of the mechanistic study of the cyclooxygenases.
Synonyms: N-(2-Cyclohexyloxy-4-nitrophenyl)methanesulfonamideMaaT013
go.drugbank.com/drugs/DB18648InvestigationalMaaT013 is an allogeneic fecal microbiota therapy. It is being investigated for the treatment of Graft-Versus-Host Disease.
S64315
go.drugbank.com/drugs/DB17559InvestigationalS64315 (MIK665) is an inhibitor of induced myeloid leukemia cell differentiation protein Myeloid cell leukemia 1 (Mcl-1).[A257311]
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Aloglutamol
go.drugbank.com/drugs/DB13650InvestigationalAloglutamol is an antacid salt of aluminium, gluconic acid, and tris. Proprietary names include Altris, Pyreses, Tasto and Sabro.
Iomethin I-125
go.drugbank.com/drugs/DB20779ExperimentalIomethin I-125 is a small molecule drug. Iomethin I-125 has a monoisotopic molecular weight of 353.05 Da.