Search
Denifanstat
go.drugbank.com/drugs/DB17576InvestigationalDenifanstat is an orally bioavailable fatty acid synthase (FASN) inhibitor. Due to its antineoplastic activities, it is being investigated for various cancers.
Categories: Heterocyclic Compounds, 1-RingSynonyms: Benzonitrile, 4-(1-(4-cyclobutyl-2-methyl-5-(3-methyl-1h-1,2,4-triazol-5-yl)benzoyl)-4-piperidinyl)-E1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the _SMN2_ gene which is under investigation for the treatment of spinal muscular atrophy (SMA).[L48196]
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')LY-517717
go.drugbank.com/drugs/DB05713InvestigationalLY517717 is an investigational oral direct inhibitor of activated Factor Xa. It is believed to be Lilly's PMD-3112 (licensed from Amgen).
Categories: Heterocyclic Compounds, 1-RingMAHDL01
go.drugbank.com/drugs/DB06270ExperimentalMAHDL01 is a pharmaceutical combination of whole plants, which is used to increase the HDL/LDL ratio that improves overall cardiovascular health.
Demexiptiline
go.drugbank.com/drugs/DB08998ExperimentalDemexiptiline is marketed under the names Deparon or Tinoran. It is a tricyclic antidepressant which acts primarily as a norepinephrine reuptake inhibitor.
UB-612
go.drugbank.com/drugs/DB16444InvestigationalIn rats, toxicity studies have so far shown favourable safety for this vaccine[L30653, L30658], Phase 1 trial is currently ongoing in Taiwan (NCT04545749). … The vaccine incorporates a strong S1-RBD component linked to a single chain fragment region (sFC) of a human IgG1, which facilitates cell attachment and acts as the principal neutralizing domain of the
Zinc picolinate
go.drugbank.com/drugs/DB11175InvestigationalZinc picolinate is a zinc salt of picolinic acid. It is available as OTC dietary supplements as a source of zinc to treat and prevent zinc deficiency. … The absorption of zinc after oral administration of zinc picolinate is shown to be effective.
Categories: Heterocyclic Compounds, 1-Ring, Compounds used in a research, industrial, or household settingEthanolamine
go.drugbank.com/drugs/DB03994InvestigationalA viscous, hygroscopic amino alcohol with an ammoniacal odor. It is widely distributed in biological tissue and is a component of lecithin. … It is used as a surfactant, fluorimetric reagent, and to remove CO2 and H2S from natural gas and other gases.
Synonyms: 2-AminoethanolStreptococcus pneumoniae type 1 capsular polysaccharide diphtheria CRM197 protein conjugate antigen
go.drugbank.com/drugs/DB10293ApprovedInvestigationalStreptococcus pneumoniae type 1 capsular polysaccharide diphtheria CRM197 protein conjugate antigen is a sterile vaccine that contains saccharides of the capsular antigens of *Streptococcus pneumoniae* … serotype 1 individually conjugated to the CRM197 protein, a nontoxic variant of diphtheria toxin isolated from cultures of *Corynebacterium diphtheriae* strain C7 (β197).
Synonyms: Streptococcus pneumoniae serotype 1 capsular antigen diphtheria CRM197 protein conjugate vaccine, Streptococcus pneumoniae type 1 capsular polysaccharide diphtheria CRM197 protein conjugate antigenStreptococcus pneumoniae type 3 capsular polysaccharide diphtheria CRM197 protein conjugate antigen
go.drugbank.com/drugs/DB10294ApprovedInvestigationalStreptococcus pneumoniae type 3 capsular polysaccharide diphtheria CRM197 protein conjugate antigen is a sterile vaccine that contains saccharides of the capsular antigens of *Streptococcus pneumoniae* … serotype 3 individually conjugated to the CRM197 protein, a nontoxic variant of diphtheria toxin isolated from cultures of *Corynebacterium diphtheriae* strain C7 (β197).
Synonyms: Streptococcus pneumoniae serotype 3 capsular antigen diphtheria CRM197 protein conjugate vaccine, Streptococcus pneumoniae type 3 capsular polysaccharide diphtheria CRM197 protein conjugate antigen