Search
Dasiprotimut-T
go.drugbank.com/drugs/DB17287ExperimentalDasiprotimut-T is a personalized therapeutic vaccine against B-cell lymphomas.[A254701] It has been investigated in clinical trials.
Categories: dasiprotimut-TSynonyms: Dasiprotimut-TBB-1701
go.drugbank.com/drugs/DB17443InvestigationalBB-1701 is a humanized IgG1 kappa monoclonal antibody (anti-HER2 antibody) conjugated to eribulin developed by Bliss Biopharmaceutical.
S64315
go.drugbank.com/drugs/DB17559InvestigationalS64315 (MIK665) is an inhibitor of induced myeloid leukemia cell differentiation protein Myeloid cell leukemia 1 (Mcl-1).[A257311]
Synonyms: S 64315Rivabazumab pegol
go.drugbank.com/drugs/DB17788InvestigationalRivabazumab pegol is being investigated as a treatment of Pseudomonas aeruginosa lung infections in patients with cystic fibrosis.[A259457]
Synonyms: KB001-A, KB001-A (AN ANTI-PCRV PEGYLATED MONOCLONAL ANTIBODY FRAGMENT TO THE TYPE III SECRETION SYSTEM OF PSEUDOMONAS AERUGINOSA)IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'CEQ508
go.drugbank.com/drugs/DB17911ExperimentalCEQ508 is a Live Attenuated E. Coli Expressing Beta Catenin ShRNA currently being investigated to treat Familial Adenomatous Polyposis.
E59
go.drugbank.com/drugs/DB18372ExperimentalE59 is a humanized IgG1 low affinity allergic reactivity inhibiting (LARI) monoclonal antibody. It was developed by Sixal Inc.
SEL-302
go.drugbank.com/drugs/DB18434InvestigationalSEL-302 is a recombinant adeno-associated virus vector-based gene therapy expressing the methylmalonyl-CoA mutase (MMUT) transgene.
Posdinemab
go.drugbank.com/drugs/DB18941InvestigationalPosdinemab is under investigation in clinical trial NCT04619420 (A Study of JNJ-63733657 in Participants With Early Alzheimer's Disease).
Synonyms: Immunoglobulin G1, anti-(human phosphorylated tau protein) (human-Mus musculus monoclonal JNJ-63733657 γ1-chain), disulfide with human-Mus musculus monoclonal JNJ-63733657 κ-chain, dimerClesacostat
go.drugbank.com/drugs/DB18956InvestigationalClesacostat is under investigation in clinical trial NCT04321031 (Metabolic Interventions to Resolve Non-alcoholic Steatohepatitis (NASH) With Fibrosis (MIRNA)).
Synonyms: 4-(6-methoxy-4-(7-oxo-1-(propan-2-yl)-1,4,6,7-tetrahydrospiro(indazole-5,4'- piperidine)-1'-carbonyl)pyridin-2-yl)benzoic acid, Benzoic acid, 4-(6-methoxy-4-((1,4,6,7-tetrahydro-1-(1-methylethyl)-7-oxospiro(5h-indazole-5,4'-piperidin)-1'-yl)carbonyl)-2-pyridinyl)-