| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Harilaou | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | North Dallas | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Asahikawa | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Durham | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Stonybrook | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Wayne | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Aveiro | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Cleveland Corum | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Lille | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Bangkok | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Sugao | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | La Jolla | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Wexham | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Piotrkow | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | West Virginia | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Omiya | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Nara | Not Available | - 953_976delCCACCAAAGGGTACCTGGAC GACC
| ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Manhattan | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Rehevot | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Honiara | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Tokyo, Fukushima | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Chatham | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Fushan | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Partenope | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |
| Mafenide | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Ierapetra | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia. | Details |