| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Nara | Not Available | - 953_976delCCACCAAAGGGTACCTGGAC GACC
| ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Manhattan | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Rehevot | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Honiara | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Tokyo, Fukushima | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Chatham | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Fushan | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Partenope | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Ierapetra | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Anadia | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Abeno | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Surabaya | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Pawnee | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | S. Antioco | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Cassano | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Hermoupolis | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Union,Maewo, Chinese-2, Kalo | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Andalus | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Cosenza | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Canton, Taiwan- Hakka, Gifu-like, Agrigento-like | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Flores | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Kaiping, Anant, Dhon, Sapporo-like, Wosera | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Kamogawa | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Costanzo | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |
| Pegloticase | Glucose-6-phosphate 1-dehydrogenase Gene symbol: G6PD UniProt: P11413 | Amazonia | Not Available | | ADR Inferred | Increased risk of potentially fatal hemolytic anemia and methemoglobinemia. | Details |