

Pegloticase is a recombinant uricase used for the treatment of chronic gout in adult patients refractory to conventional therapy.

Brand Names
Generic Name
DrugBank Accession Number

Pegloticase is a porcine recombinant PEGylated uricase indicated for the treatment of chronic gout in adult patients that do not respond to other types of therapies.5 Pegloticase has a similar activity to rasburicase, an enzyme that metabolizes uric acid to allantoin. In gout patients treated with pegloticase, the conversion of uric acid to allantoin leads to lower plasma uric acid concentrations.5

Pegloticase has a longer terminal elimination half-life thanks to the addition of a polyethylene glycol (PEG) group. Therefore therapeutic drug levels can be maintained with infrequent and relatively low pegloticase doses.3 The PEG group also gives pegloticase a lower potential to induce an immune response.3 However, cases of anaphylaxis and infusion reactions have been reported in patients treated with this drug.5 Pegloticase was approved by the FDA in 2014, and in 2022, the drug label included the co-administration of pegloticase and methotrexate.5

Approved, Investigational
Biologic Classification
Protein Based Therapies
Recombinant Enzymes
Protein Chemical Formula
Protein Average Weight
34192.8533 Da
> Pegloticase
  1. United States Adopted Name (USAN): Pegloticase statement on a non-propietary name adopted by the USAN Council [Link]
Download FASTA Format
  • Pegloticase
  • Puricase



Pegloticase is a PEGylated uric acid specific enzyme indicated for the treatment of chronic gout in adult patients refractory to conventional therapy.5

Reduce drug development failure rates
Build, train, & validate machine-learning models
with evidence-based and structured datasets.
See how
Build, train, & validate predictive machine-learning models with structured datasets.
See how
Associated Conditions
Contraindications & Blackbox Warnings
Avoid life-threatening adverse drug events
Improve clinical decision support with information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.
Learn more
Avoid life-threatening adverse drug events & improve clinical decision support.
Learn more

Pegloticase is a uricase enzyme conjugated with mPEG with an average degree of substitution of 40.8 moles of mPEG/mole of protein.6 In patients treated with 8 mg of pegloticase, mean plasma uric acid levels were 0.7 mg/dL approximately 24 hours after the first dose.5 In comparison, subjects in the placebo group had a mean plasma uric acid level of 8.2 mg/dL. The decrease in plasma uric acid was sustained for long periods. Patients treated with 8-12 mg of pegloticase had a uric acid concentration equal to or lower than 6 mg/dL for more than 300 h.5

Cases of anaphylaxis have been reported in patients treated with pegloticase. In most cases, anaphylaxis manifests within 2 hours of infusion; however, delayed hypersensitivity reactions may also occur. Anaphylaxis risk is higher in patients with uric acid levels above 6 mg/dL.5 In patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency, pegloticase may lead to life-threatening hemolytic reactions and methemoglobinemia. Patients treated with pegloticase may also experience infusion reactions, gout flares, and congestive heart failure.5

Mechanism of action

Gout is characterized by the presence of hyperuricemia, a biochemical abnormality where the concentration of serum urate is higher or equal to 6.8 mg/dl.1 Pegloticase is a PEGylated recombinant modified mammalian urate oxidase (uricase) that converts uric acid into allantoin, an inert and highly water-soluble metabolite, with hydrogen peroxide and carbon dioxide as by-products of this reaction.5,6,4 Allantoin is excreted by the kidneys, and this reduces the amount of uric acid in serum. The reduction in serum uric acid induces a concentration gradient that promotes the migration of urate from joints and tissues, making it readily available for allantoin conversion.5,6

AUric acid

In patients with symptomatic gout given single-dose intravenous infusions of pegloticase (0.5 to 12 mg), maximum serum concentrations of pegloticase increased in a dose proportional manner.5 The AUC increased linearly up to a dose of 8 mg.2 Pegloticase administered intravenously has a Tmax of 2.25 h (range from 1.92 to 4.25 h), a Cmax of 2.17 µg/ml (range from 1.25 to 4.77 µg/ml), and an AUC0-t of 445 h⋅µg/ml (range from 223 to 1040 h⋅µg/ml).6 Since pegloticase is administered intravenously, it is expected that it has a bioavailability close to 100%. The pharmacokinetic profile of pegloticase is not significantly influenced by age, sex, weight, and creatinine clearance; however, it is affected by body surface area and anti-pegloticase antibodies.5

Volume of distribution

The volume of distribution of pegloticase ranges from 5 to 10 L.2

Protein binding

This pharmacokinetic property has not been studied.


As a recombinant enzyme, pegloticase is expected to be metabolized by proteases throughout the body.

Route of elimination

Nonclinical studies suggest that pegloticase is renally excreted. Due to the PEG moiety pegloticase, urinary excretion is likely to be the primary route of elimination.6


In patients with symptomatic gout given single-dose intravenous infusions of pegloticase (0.5 to 12 mg), half-life ranged from 6.4 to 13.8 days. The mean plasma half-life of pegloticase was 300 hr or 12.5 days.2 In a second study where gout patients were given 4 to 12 mg of pegloticase intravenously every 2 or 4 weeks, the mean terminal elimination half-life of pegloticase in serum was approximately 2 weeks long, ranging from 170 to 1049 hours.3


In gout patients given 4 to 12 mg of pegloticase intravenously every 2 or 4 weeks, clearance was ​​0.0615 L/month/kg.3

Adverse Effects
Improve decision support & research outcomes
With structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates.
Learn more
Improve decision support & research outcomes with our structured adverse effects data.
Learn more

No pegloticase overdose cases have been reported. The single maximum intravenous dose that has been administered is 12 mg as uricase protein.5 Patients experiencing an overdose are at an increased risk of severe adverse effects such as anaphylaxis, gout flares and congestive heart failure. The drug label recommends to monitor patients suspected of experiencing a pegloticase overdose, and initiate general supportive measures as no specific antidote has been identified.5

The carcinogenic and genotoxic potential of pegloticase has not been evaluated. At doses up to 40 mg/kg, pegloticase did not show evidence of fertility impairment in rats (dose equivalent to 50 times the maximum recommended human dose.5

Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
AllopurinolThe risk or severity of adverse effects can be increased when Allopurinol is combined with Pegloticase.
Antihemophilic factor (recombinant), PEGylatedThe therapeutic efficacy of Antihemophilic factor (recombinant), PEGylated can be decreased when used in combination with Pegloticase.
BendroflumethiazideThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Bendroflumethiazide.
BenziodaroneThe risk or severity of adverse effects can be increased when Benziodarone is combined with Pegloticase.
BenzthiazideThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Benzthiazide.
Certolizumab pegolThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Certolizumab pegol.
ChlorothiazideThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Chlorothiazide.
CyclopenthiazideThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Cyclopenthiazide.
CyclothiazideThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Cyclothiazide.
Damoctocog alfa pegolThe therapeutic efficacy of Damoctocog alfa pegol can be decreased when used in combination with Pegloticase.
Identify potential medication risks
Easily compare up to 40 drugs with our drug interaction checker.
Get severity rating, description, and management advice.
Learn more
Food Interactions
No interactions found.


Drug product information from 10+ global regions
Our datasets provide approved product information including:
dosage, form, labeller, route of administration, and marketing period.
Access now
Access drug product information from over 10 global regions.
Access now
Brand Name Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing EndRegionImage
KrystexxaInjection, solution, concentrate8 mg/mlIntravenousCrealta Pharmaceuticals Llc2016-09-082016-07-22EU flag
KrystexxaInjection, solution8 mg/1mLIntravenousSavient Pharmaceuticals2010-09-14Not applicableUS flag
KrystexxaInjection, solution8 mg/1mLIntravenousHorizon Pharma Inc.2010-09-142018-12-31US flag
KrystexxaInjection, solution8 mg/1mLIntravenousHorizon Therapeutics USA, Inc.2010-09-14Not applicableUS flag


ATC Codes
M04AX02 — Pegloticase
Drug Categories
Chemical TaxonomyProvided by Classyfire
Not Available
Organic Compounds
Super Class
Organic Acids
Carboxylic Acids and Derivatives
Sub Class
Amino Acids, Peptides, and Analogues
Direct Parent
Alternative Parents
Not Available
Not Available
Molecular Framework
Not Available
External Descriptors
Not Available
Affected organisms
  • Humans and other mammals

Chemical Identifiers

CAS number


Synthesis Reference

Hartman, J., et al. (2006). Variant form of urate oxidase and use thereof (U.S. Patent No. 8,293,228 B2). U.S. Patent and Trademark Office.

General References
  1. Sattui SE, Gaffo AL: Treatment of hyperuricemia in gout: current therapeutic options, latest developments and clinical implications. Ther Adv Musculoskelet Dis. 2016 Aug;8(4):145-59. doi: 10.1177/1759720X16646703. Epub 2016 May 2. [Article]
  2. Sundy JS, Ganson NJ, Kelly SJ, Scarlett EL, Rehrig CD, Huang W, Hershfield MS: Pharmacokinetics and pharmacodynamics of intravenous PEGylated recombinant mammalian urate oxidase in patients with refractory gout. Arthritis Rheum. 2007 Mar;56(3):1021-8. doi: 10.1002/art.22403. [Article]
  3. Yue CS, Huang W, Alton M, Maroli AN, Waltrip RW, Wright D, Marco MD: Population pharmacokinetic and pharmacodynamic analysis of pegloticase in subjects with hyperuricemia and treatment-failure gout. J Clin Pharmacol. 2008 Jun;48(6):708-18. doi: 10.1177/0091270008317589. Epub 2008 Apr 16. [Article]
  4. Shannon JA, Cole SW: Pegloticase: a novel agent for treatment-refractory gout. Ann Pharmacother. 2012 Mar;46(3):368-76. doi: 10.1345/aph.1Q593. Epub 2012 Mar 6. [Article]
  5. FDA Approved Drug Products: KRYSTEXXA (pegloticase) injection for intravenous use [Link]
  6. EMA Summary of Product Characteristics: KRYSTEXXA (pegloticase) injection for intravenous use [Link]
PubChem Substance
RxList Drug Page Drug Page

Clinical Trials

Clinical Trials
4Active Not RecruitingTreatmentUncontrolled Gout1
4CompletedTreatmentGouty Arthritis2
4CompletedTreatmentKidney Transplantation / Uncontrolled Gout1
4RecruitingTreatmentChronic Uncontrolled Gout / Gouty Arthritis / Uncontrolled Gout1
4RecruitingTreatmentGout Chronic / Uncontrolled Gout1
4RecruitingTreatmentHematopoietic and Lymphoid Cell Neoplasm / Malignant Solid Neoplasms / Tumour lysis syndrome1
3CompletedTreatmentChronic Gout Refractory to Conventional Therapy1
3CompletedTreatmentGouty Arthritis2
2CompletedOtherGouty Arthritis1
2CompletedTreatmentGout Chronic2


Not Available
Not Available
Dosage Forms
Injection, solutionIntravenous8 mg/1mL
Injection, solution, concentrateIntravenous8 MG/ML
Not Available
Not Available


Experimental Properties
Not Available

Drug created at October 20, 2015 19:34 / Updated at September 05, 2022 12:50