Search
Vespula vulgaris venom protein
go.drugbank.com/drugs/DB11033ApprovedVespula vulgaris venom protein is an extract of Vespula vulgaris venom. Vespula vulgaris venom protein is used in allergenic testing.
Turmeric
go.drugbank.com/drugs/DB14276ApprovedInvestigationalTurmeric is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Synonyms: Ae-turmericCategories: Compounds used in a research, industrial, or household settingPurslane
go.drugbank.com/drugs/DB14327ApprovedPurslane is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
AVB-001
go.drugbank.com/drugs/DB18452InvestigationalAVB-001 is an encapsulated, engineered human ARPE-19 cell line that constitutively expresses the native human IL-2 cytokine
BBT-877
go.drugbank.com/drugs/DB18668InvestigationalBBT-877 is an autotaxin enzyme inhibitor being investigated for the treatment of fibrotic diseases, such as idiopathic pulmonary fibrosis.
Rifabutin
go.drugbank.com/drugs/DB00615ApprovedInvestigationalA broad-spectrum antibiotic that is being used as prophylaxis against disseminated Mycobacterium avium complex infection in HIV-positive patients.
Butyric Acid
go.drugbank.com/drugs/DB03568InvestigationalA four carbon acid, CH3CH2CH2COOH, with an unpleasant odor that occurs in butter and animal fat as the glycerol ester.
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Ceftobiprole medocaril
go.drugbank.com/drugs/DB14733ApprovedCeftobiprole medocaril is a prodrug of [ceftobiprole], a fifth-generation semisynthetic cephalosporin antibacterial. … Ceftobiprole is a broad-spectrum agent with demonstrated activity against both Gram-positive and Gram-negative bacteria, including antibiotic-resistant strains of _Staphylcoccus aureus_ (methicillin-resistant