Search
Nepafenac
go.drugbank.com/drugs/DB06802ApprovedInvestigationalNepafenac is a non-steroidal anti-inflammatory prodrug (NSAID) usually sold as a prescription eye drop. It is used to treat pain and inflammation associated with cataract surgery.
Categories: Selective Cyclooxygenase 2 Inhibitors (NSAIDs)Synonyms: 2-amino-3-benzoylbenzeneacetamideSuvorexant
go.drugbank.com/drugs/DB09034ApprovedInvestigationalSuvorexant is a selective dual antagonist of orexin receptors OX1R and OX2R that promotes sleep by reducing wakefulness and arousal. It has been approved for the treatment of insomnia.
Categories: Heterocyclic Compounds, 1-Ring, P-glycoprotein inhibitorsProducts: BELSOMRA® 10 MG, BELSOMRA® 15 MGIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Oxazepam
go.drugbank.com/drugs/DB00842Approved[A203516] It is an active metabolite of both [diazepam] and [temazepam][A39486] and undergoes very little biotransformation following absorption, making it unlikely to participate in pharmacokinetic interactions … Oxazepam is an intermediate-acting, 3-hydroxybenzodiazepine used in the treatment of alcohol withdrawal and anxiety disorders.
Categories: Heterocyclic Compounds, 2-RingProducts: Praxiten 50 mg - Tabletten, Anxiolit forte 50 mg - TablettenBCG vaccine
go.drugbank.com/drugs/DB12768ApprovedInvestigationalWithdrawnBCG vaccine has been investigated for the treatment of Neoplasms, Bladder Cancer, Neoplasms by Site, Urologic Diseases, and Urologic Neoplasms, among others.
Products: BCG CULTURE SSI 30 MG 4 VIAL, CALGEVAX-BCG 11.25 MG INTRAVEZIKAL ENJEKSIYON IÇIN LIYOFILIZE TOZ IÇEREN AMPUL, 10 ADETVildagliptin
go.drugbank.com/drugs/DB04876ApprovedInvestigationalIt is used to manage type II diabetes mellitus, where GLP-1 secretion and insulinotropic effects are impaired. … [A232488] By inhibiting DPP-4, vildagliptin prevents the degradation of glucagon-like peptide 1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP), which are incretin hormones that promote
Mixtures: GALVUS MET (50 MG/850 MG), GALVUS MET (50 MG/1000 MG)Categories: Glucagon-Like Peptide 1, Heterocyclic Compounds, 1-RingImiquimod
go.drugbank.com/drugs/DB00724ApprovedInvestigationalImiquimod does not fight the viruses that cause warts directly, however, it does help to relieve and control wart production. … Imiquimod is an immune response modifier that acts as a toll-like receptor 7 agonist. Imiquimod is commonly used topically to treat warts on the skin of the genital and anal areas.
Mixtures: Imiquimod 5% / Levocetirizine Dihydrochloride 1% / Niacinamide 2%, Imiquimod 5% / Levocetirizine Dihydrochloride 1% / Tretinoin 0.05%Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 2-RingGalcanezumab
go.drugbank.com/drugs/DB14042ApprovedInvestigational[L42060] It is unknown if galcanezumab has an effect on pregnancy outcomes. A pregnancy exposure registry has been established to evaluate the safety of this drug in pregnant women.[L42060] … Galcanezumab is a humanized monoclonal antibody developed by Eli Lilly and Company against human calcitonin gene-related peptide (CGRP).
Products: EMGALİTY 120 MG/ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR KALEM, 1 ADET, EMGALİTY 120 MG/ML ENJEKSİYONLUK ÇÖZELTİ İÇEREN KULLANIMA HAZIR KALEM, 2 ADETPrednisolone phosphate
go.drugbank.com/drugs/DB14631ApprovedInvestigationalVet approved[A187463] Prednisolone phosphate was granted FDA Approval on 19 December 1973.[L14144] … Prednisolone phosphate is a glucocorticoid similar to [cortisol] used for its anti-inflammatory, immunosuppressive, anti-neoplastic, and vasoconstrictive effects.
Mixtures: OFTALETYC® NFCategories: P-glycoprotein inducers, Cytochrome P-450 CYP2A6 InducersTrihexyphenidyl
go.drugbank.com/drugs/DB00376ApprovedInvestigational[L31843] It has largely been replaced by drugs such as [levodopa].[L31843] Trihexyphenidyl was granted FDA approval on 13 May 1949.[L31768] … [L31773,L31778] Its discovery was published in 1949 in a study looking for drugs with antispasmodic activity.
International brands: Ea TenCategories: Heterocyclic Compounds, 1-Ring