Search
Doxapram
go.drugbank.com/drugs/DB00561ApprovedInvestigationalVet approvedA central respiratory stimulant with a brief duration of action. (From Martindale, The Extra Pharmocopoeia, 30th ed, p1225)
Categories: Heterocyclic Compounds, 1-RingSynonyms: 1-ethyl-4-(2-morpholinoethyl)-3,3-diphenyl-2-pyrrolidinoneSuvorexant
go.drugbank.com/drugs/DB09034ApprovedInvestigationalSuvorexant is a selective dual antagonist of orexin receptors OX1R and OX2R that promotes sleep by reducing wakefulness and arousal. It has been approved for the treatment of insomnia.
Categories: Heterocyclic Compounds, 1-Ring, P-glycoprotein inhibitorsProducts: BELSOMRA® 10 MG, BELSOMRA® 15 MGPeginterferon alfa-2b
go.drugbank.com/drugs/DB00022ApprovedInvestigationalWhen combined together, Peginterferon alfa-2b and [Ribavirin] have been shown to achieve a SVR between 41% for genotype 1 and 75% for genotypes 2-6 after 48 weeks of treatment. … Peginterferon alfa-2b is derived from the alfa-2b moeity of recombinant human interferon and acts by binding to human type 1 interferon receptors.
Categories: Hepatitis C, Interferon Type ISynonyms: PEG-IFN-α-2b, Pegylated Interferon α-2bBicalutamide
go.drugbank.com/drugs/DB01128ApprovedInvestigationalIt is comprised of a racemic mixture that is a 50:50 composition of the (R)-bicalutamide and (S)-bicalutamide enantionmers. Bicalutamide binds to the androgen receptor.
Categories: Cytochrome P-450 CYP3A4 Substrates with a Narrow Therapeutic Index, P-glycoprotein inhibitorsProducts: BICALUTAMIDE EG, BICALUTAMIDE EG STADAIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Oxazepam
go.drugbank.com/drugs/DB00842Approved[A203516] It is an active metabolite of both [diazepam] and [temazepam][A39486] and undergoes very little biotransformation following absorption, making it unlikely to participate in pharmacokinetic interactions … Oxazepam is an intermediate-acting, 3-hydroxybenzodiazepine used in the treatment of alcohol withdrawal and anxiety disorders.
Categories: Heterocyclic Compounds, 2-RingProducts: Praxiten 50 mg - Tabletten, Anxiolit forte 50 mg - TablettenBCG vaccine
go.drugbank.com/drugs/DB12768ApprovedInvestigationalWithdrawnBCG vaccine has been investigated for the treatment of Neoplasms, Bladder Cancer, Neoplasms by Site, Urologic Diseases, and Urologic Neoplasms, among others.
Products: BCG CULTURE SSI 30 MG 4 VIAL, CALGEVAX-BCG 11.25 MG INTRAVEZIKAL ENJEKSIYON IÇIN LIYOFILIZE TOZ IÇEREN AMPUL, 10 ADETCanakinumab
go.drugbank.com/drugs/DB06168ApprovedInvestigationalCanakinumab binds to human IL-1β and neutralizes its inflammatory activity by blocking its interaction with IL-1 receptors, but it does not bind IL-1alpha or IL-1 receptor antagonist (IL-1ra). … It is expressed in a murine Sp2/0-Ag14 cell line and comprised of two 447- (or 448-) residue heavy chains and two 214-residue light chains, with a molecular mass of 145157 Daltons when deglycosylated.
Categories: Interleukin-1 Blockers, Interleukin-1β BlockersProducts: İLARİS 150 MG/ML ENJEKSİYONLUK ÇÖZELTİ, 1 ADET, ILARIS® SOLUCIÓN INYECTABLE 150 MG/ MLVildagliptin
go.drugbank.com/drugs/DB04876ApprovedInvestigationalIt is used to manage type II diabetes mellitus, where GLP-1 secretion and insulinotropic effects are impaired. … [A232488] By inhibiting DPP-4, vildagliptin prevents the degradation of glucagon-like peptide 1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP), which are incretin hormones that promote
Mixtures: GALVUS MET (50 MG/850 MG), GALVUS MET (50 MG/1000 MG)Categories: Glucagon-Like Peptide 1, Heterocyclic Compounds, 1-RingImiquimod
go.drugbank.com/drugs/DB00724ApprovedInvestigationalImiquimod does not fight the viruses that cause warts directly, however, it does help to relieve and control wart production. … Imiquimod is an immune response modifier that acts as a toll-like receptor 7 agonist. Imiquimod is commonly used topically to treat warts on the skin of the genital and anal areas.
Mixtures: Imiquimod 5% / Levocetirizine Dihydrochloride 1% / Niacinamide 2%, Imiquimod 5% / Levocetirizine Dihydrochloride 1% / Tretinoin 0.05%Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 2-Ring