Search
Octrizole
go.drugbank.com/drugs/DB21133ExperimentalOctrizole is a small molecule drug. Octrizole has a monoisotopic molecular weight of 323.2 Da.
Synonyms: Bisoctrizole related compound aTretinoin
go.drugbank.com/drugs/DB00755ApprovedInvestigationalNutraceuticalTretinoin, also known as all-trans-retinoic acid (ATRA), is a naturally occurring derivative of [vitamin A] (retinol). … [A257474] It is an oxidation product in the physiological pathway of vitamin A metabolism.
Synonyms: Vitamin A acid, all-trans-Vitamin A acidInternational brands: Stieva-APelareorep
go.drugbank.com/drugs/DB17284InvestigationalSynonyms: Reovirus type 3 dearing oncolytic virus without transgenes, Reovirus type 3 (strain dearing) (t3d) (mammalian orthoreovirus 3)Rosomidnar
go.drugbank.com/drugs/DB17154InvestigationalSynonyms: (3'-5')d(c-a-c-g-c-a-c-g-c-g-c-a-t-c-c-c-c-g-c-c-c-g-t-g)Pancrelipase amylase
go.drugbank.com/drugs/DB11065ApprovedInvestigational[T177] The pancrelipase amylase is a single polypeptide chain containing two SH groups and four disulfide bridges. … Pancrelipase, in general, is composed of a mixture of pancreatic enzymes which include amylases, lipases, and proteases. These enzymes are extracted from porcine pancreatic glands.
Mixtures: Creon 8 Cap, Cotazym Ecs 8Synonyms: Amylase A, Amylase ADSelpercatinib
go.drugbank.com/drugs/DB15685ApprovedInvestigationalSelpercatinib is a kinase inhibitor with enhanced specificity for RET tyrosine kinase receptors (RTKs) over other RTK classes. … [A202055, A202052, L13604] Enhanced RET (Rearranged during transfection) oncogene expression is a hallmark of many cancers.
Categories: MATE 1 Inhibitors, P-glycoprotein inhibitorsSynonyms: 6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazabicyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrileBesigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Categories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsSynonyms: Gomisin a, (+)-gomisin aBakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolNeutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin has a monoisotopic molecular weight of 686.35 Da. … Neutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'