Search
Zopapogene imadenovec
go.drugbank.com/drugs/DB24672ApprovedInvestigational[L54081] Zopapogene imadenovec is a non-replicating adenoviral vector–based immunotherapy that expresses a fusion antigen from selected regions of HPV-6/11 proteins to elicit an immune response in RRP. … Recurrent respiratory papillomatosis (RRP) is a rare, debilitating disease driven by chronic human papillomavirus (HPV) 6 or 11 infection and characterized by recurrent benign tumors in the respiratory
Synonyms: under control of a human cytomegalovirus (CMV) promoter and terminated with a 3' untranslated region and a simian virus 40 (SV40) polyadenylation signal, DNA (recombinant replication-deficient Gorilla gorilla gorilla adenovirus strain GC4 vector PRGN-2012 human cytomegalovirus promoter plus human papillomavirus 6/11 E2, E4, E6, E7 protein 11 epitope-containing2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide-a
go.drugbank.com/drugs/DB15243Investigational2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide-a is under investigation in clinical trial NCT01668823 (Photodynamic Therapy in Treating Patients With Lung Cancer).
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds with 4 or More RingsSynonyms: 2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide-a, 3-PHORBINEPROPANOIC ACID, 14-ETHYL-9-(1-(HEXYLOXY)ETHYL)-4,8,13,18-TETRAMETHYL-20-OXO-, (3S,4S)-9-(N-methyl-L-isoleucine)-cyclosporin A
go.drugbank.com/drugs/DB13068Investigational9-(N-methyl-L-isoleucine)-cyclosporin A (NIM811) has been used in trials studying the treatment of Chronic Hepatitis C Genotype-1 Relapse.
Rosomidnar
go.drugbank.com/drugs/DB17154InvestigationalSynonyms: (3'-5')d(c-a-c-g-c-a-c-g-c-g-c-a-t-c-c-c-c-g-c-c-c-g-t-g)Besigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Synonyms: Gomisin a, (+)-gomisin aCategories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsTretinoin
go.drugbank.com/drugs/DB00755ApprovedInvestigationalNutraceuticalTretinoin, also known as all-trans-retinoic acid (ATRA), is a naturally occurring derivative of [vitamin A] (retinol). … [A257474] It is an oxidation product in the physiological pathway of vitamin A metabolism.
Synonyms: Vitamin A acid, all-trans-Vitamin A acidInternational brands: Stieva-ABakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Neutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin has a monoisotopic molecular weight of 686.35 Da. … Neutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-Narasin
go.drugbank.com/drugs/DB11432ExperimentalVet approvedNarasin is an agent with coccidiostatic and antibacterial properties.
Categories: Heterocyclic Compounds, 1-RingSynonyms: Narasin A