Search
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
NS-398
go.drugbank.com/drugs/DB14060ExperimentalNS-398 is a COX-2 inhibitor. It was developed as part of the mechanistic study of the cyclooxygenases.
Synonyms: N-(2-Cyclohexyloxy-4-nitrophenyl)methanesulfonamideMaaT013
go.drugbank.com/drugs/DB18648InvestigationalMaaT013 is an allogeneic fecal microbiota therapy. It is being investigated for the treatment of Graft-Versus-Host Disease.
S64315
go.drugbank.com/drugs/DB17559InvestigationalS64315 (MIK665) is an inhibitor of induced myeloid leukemia cell differentiation protein Myeloid cell leukemia 1 (Mcl-1).[A257311]
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Aloglutamol
go.drugbank.com/drugs/DB13650InvestigationalAloglutamol is an antacid salt of aluminium, gluconic acid, and tris. Proprietary names include Altris, Pyreses, Tasto and Sabro.
Iomethin I-125
go.drugbank.com/drugs/DB20779ExperimentalIomethin I-125 is a small molecule drug. Iomethin I-125 has a monoisotopic molecular weight of 353.05 Da.
Hyaluronidase
go.drugbank.com/drugs/DB14740ApprovedInvestigationalHyaluronidase is an enzyme used to improve the absorption and dispersion of parenterally administered fluids, drugs, and contrast agents. … [A199026] Early research into hyaluronidase identified it as a "spreading factor" which allowed for increased permeability of the connective tissue.
Products: POLVO LIOFILIZADO PARA RECONSTITUIR A SOLUCION PARA ADMINISTRACIÓN OFTALMICATaurolidine
go.drugbank.com/drugs/DB12473ApprovedInvestigationalTaurolidine is an antimicrobial used for the prevention of catheter-related infections. It is a derivative of the amino acid [taurine]. … and Antifungal Drugs (LPAD pathway) for the prevention of catheter-related bloodstream infections in a limited and specific patient population.
Nemolizumab
go.drugbank.com/drugs/DB15252ApprovedInvestigationalNemolizumab is a humanized monoclonal modified immunoglobulin 2 (IgG2) antibody directed against interleukin-31 receptor alpha (IL-31RA),[L51159] which is an endogenous cytokine implicated in the pathophysiology
Synonyms: Immunoglobulin G2, anti-(interleukin 31 receptor A) (human-Mus musculus monoclonal CIM331 γ-chain), disulfide with human-Mus musculus monoclonal CIM331 κ-chain, dimer