Search
Selpercatinib
go.drugbank.com/drugs/DB15685ApprovedInvestigationalSelpercatinib is a kinase inhibitor with enhanced specificity for RET tyrosine kinase receptors (RTKs) over other RTK classes. … [A202055, A202052, L13604] Enhanced RET (Rearranged during transfection) oncogene expression is a hallmark of many cancers.
Categories: MATE 1 Inhibitors, P-glycoprotein inhibitorsSynonyms: 6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazabicyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrileNeutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin has a monoisotopic molecular weight of 686.35 Da. … Neutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Narasin
go.drugbank.com/drugs/DB11432ExperimentalVet approvedNarasin is an agent with coccidiostatic and antibacterial properties.
Categories: Heterocyclic Compounds, 1-RingSynonyms: Narasin ATanshinone I
go.drugbank.com/drugs/DB16886ExperimentalCategories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 CYP2C9 InhibitorsSynonyms: Tanshinone A, Tanshinon I(5-BROMO-4-CHLORO-3-INDOLYL)-A-D-MANNOSE
go.drugbank.com/drugs/DB04806ExperimentalSynonyms: (5-BROMO-4-CHLORO-3-INDOLYL)-A-D-MANNOSEN,N'-DIPHENYLPYRAZOLO[1,5-A][1,3,5]TRIAZINE-2,4-DIAMINE
go.drugbank.com/drugs/DB08340ExperimentalSynonyms: N,N'-DIPHENYLPYRAZOLO[1,5-A][1,3,5]TRIAZINE-2,4-DIAMINEBarzuxetan
go.drugbank.com/drugs/DB21132ExperimentalBarzuxetan is a small molecule drug. The usage of the INN stem '-xetan' in the name indicates that Barzuxetan is a chelating agent. Barzuxetan has a monoisotopic molecular weight of 594.2 Da.
Synonyms: Chx-a''-dtpaTylosin
go.drugbank.com/drugs/DB11475ExperimentalVet approvedIt has a broad spectrum of activity against Gram-positive organisms and a limited range of Gram-negative organisms. Tylosin is produced as a fermentation product of Streptomyces fradiae. … Tylosin is a bacteriostatic macrolide antibiotic and feed additive used in veterinary medicine.
Synonyms: Tylosin AMixtures: Tylan 40 Sulfa-G PremixXempritolimod
go.drugbank.com/drugs/DB19412ExperimentalSynonyms: KMRC011, a flagellin-derived radiation countermeasure