Search
9-(N-methyl-L-isoleucine)-cyclosporin A
go.drugbank.com/drugs/DB13068Investigational9-(N-methyl-L-isoleucine)-cyclosporin A (NIM811) has been used in trials studying the treatment of Chronic Hepatitis C Genotype-1 Relapse.
Rosomidnar
go.drugbank.com/drugs/DB17154InvestigationalSynonyms: (3'-5')d(c-a-c-g-c-a-c-g-c-g-c-a-t-c-c-c-c-g-c-c-c-g-t-g)Besigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Categories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsSynonyms: Gomisin a, (+)-gomisin aTretinoin
go.drugbank.com/drugs/DB00755ApprovedInvestigationalNutraceuticalTretinoin, also known as all-trans-retinoic acid (ATRA), is a naturally occurring derivative of [vitamin A] (retinol). … [A257474] It is an oxidation product in the physiological pathway of vitamin A metabolism.
Synonyms: all-(E)-Retinoic acid, Vitamin A acidInternational brands: Stieva-ABakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Neutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin has a monoisotopic molecular weight of 686.35 Da. … Neutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-Narasin
go.drugbank.com/drugs/DB11432ExperimentalVet approvedNarasin is an agent with coccidiostatic and antibacterial properties.
Categories: Heterocyclic Compounds, 1-RingSynonyms: Narasin ATanshinone I
go.drugbank.com/drugs/DB16886ExperimentalCategories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 CYP2C9 InhibitorsSynonyms: Tanshinone A, Tanshinon IPancrelipase amylase
go.drugbank.com/drugs/DB11065ApprovedInvestigational[T177] The pancrelipase amylase is a single polypeptide chain containing two SH groups and four disulfide bridges. … Pancrelipase, in general, is composed of a mixture of pancreatic enzymes which include amylases, lipases, and proteases. These enzymes are extracted from porcine pancreatic glands.
Mixtures: Creon 8 Cap, Cotazym Ecs 8Synonyms: Amylase A, Amylase AD