Search
Octrizole
go.drugbank.com/drugs/DB21133ExperimentalOctrizole is a small molecule drug. Octrizole has a monoisotopic molecular weight of 323.2 Da.
Synonyms: Bisoctrizole related compound aPancrelipase amylase
go.drugbank.com/drugs/DB11065ApprovedInvestigationalPancrelipase, in general, is composed of a mixture of pancreatic enzymes which include amylases, lipases, and proteases. These enzymes are extracted from porcine pancreatic glands. … [T177] The pancrelipase amylase is a single polypeptide chain containing two SH groups and four disulfide bridges.
Mixtures: KREON MIKRO 5000 IU MINIMIKROSFER,, Creon 8 CapSynonyms: Amylase A, Amylase ADRosomidnar
go.drugbank.com/drugs/DB17154InvestigationalSynonyms: (3'-5')d(c-a-c-g-c-a-c-g-c-g-c-a-t-c-c-c-c-g-c-c-c-g-t-g)Besigomsin
go.drugbank.com/drugs/DB20894ExperimentalBesigomsin is a small molecule drug. Besigomsin has a monoisotopic molecular weight of 416.18 Da.
Synonyms: Gomisin a, (+)-gomisin aCategories: Compounds used in a research, industrial, or household setting, P-glycoprotein inhibitorsSelpercatinib
go.drugbank.com/drugs/DB15685ApprovedInvestigationalSelpercatinib is a kinase inhibitor with enhanced specificity for RET tyrosine kinase receptors (RTKs) over other RTK classes. … [A202055, A202052, L13604] Enhanced RET (Rearranged during transfection) oncogene expression is a hallmark of many cancers.
Categories: MATE 1 Inhibitors, P-glycoprotein inhibitorsSynonyms: 6-(2-hydroxy-2-methylpropoxy)-4-(6-(6-((6-methoxypyridin-3-yl)methyl)-3,6-diazabicyclo[3.1.1]heptan-3-yl)pyridin-3-yl)pyrazolo[1,5-a]pyridine-3-carbonitrileBakuchiol
go.drugbank.com/drugs/DB16102InvestigationalBakuchiol is under investigation in clinical trial NCT03112863 (Comparison of the Cosmetic Effects of Bakuchiol and Retinol).
Synonyms: Sytenol a, (s)-bakuchiolNeutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain. … Neutramycin has a monoisotopic molecular weight of 686.35 Da.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Narasin
go.drugbank.com/drugs/DB11432ExperimentalVet approvedNarasin is an agent with coccidiostatic and antibacterial properties.
Categories: Heterocyclic Compounds, 1-RingSynonyms: Narasin ATanshinone I
go.drugbank.com/drugs/DB16886ExperimentalCategories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 CYP2C9 InhibitorsSynonyms: Tanshinone A, Tanshinon I