Search
Relugolix
go.drugbank.com/drugs/DB11853ApprovedInvestigationalRelugolix is a gonadotropin-releasing hormone (GnRH) receptor antagonist used in the treatment of several hormone-responsive conditions. … [A225761] Relugolix is the first (and currently only) orally-administered GnRH receptor antagonist approved for the treatment of prostate cancer - similar therapies such as [degarelix] require subcutaneous
Categories: Gonadotropin Releasing Hormone Receptor AntagonistsTyrosinase
go.drugbank.com/drugs/DB16626Investigationalas melanogenesis). … [A231829, A231834, A231839] Within mammals, tyrosinase is found specifically in melanocytes in a glycosylated form and plays a critical role in regulating the process of melanin biosynthesis (also known
Synonyms: Tumor rejection antigen ABCYT006-AngQb
go.drugbank.com/drugs/DB05739InvestigationalCYT006-AngQb is a therapeutic vaccine in development for treatment of hypertension. … It is designed to instruct the patient’s immune system to produce an antibody response against angiotensin II, a small peptide that causes blood vessels to narrow and results in increased blood pressure
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Jojoba oil
go.drugbank.com/drugs/DB14252ApprovedJojoba oil is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Scutellaria lateriflora
go.drugbank.com/drugs/DB14339ApprovedScutellaria lateriflora is a plant/plant extract used in some OTC (over-the-counter) products. It is not an approved drug.
Clothiapine
go.drugbank.com/drugs/DB13256ApprovedClothiapine has been approved in European countries and is an atypical antipsychotic, shown to be useful in some treatment-resistant patients.
S-8510
go.drugbank.com/drugs/DB06504ExperimentalS-8510 / SB-737552 is a BZD inverse agonist investigated for the treatment of Alzheimer’s disease and mild to moderate senile dementia. It was being codeveloped by Shionogi and GlaxoSmithKline.
Bardoxolone
go.drugbank.com/drugs/DB12651InvestigationalIt is a synthetic triterpenoid and a highly potent activator of redox-sensitive signaling pathways that induce programmed cell death (apoptosis) in cancer cells that are under high levels of intrinsic