Search
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Aloglutamol
go.drugbank.com/drugs/DB13650InvestigationalAloglutamol is an antacid salt of aluminium, gluconic acid, and tris. Proprietary names include Altris, Pyreses, Tasto and Sabro.
Iomethin I-125
go.drugbank.com/drugs/DB20779ExperimentalIomethin I-125 is a small molecule drug. Iomethin I-125 has a monoisotopic molecular weight of 353.05 Da.
Torcetrapib
go.drugbank.com/drugs/DB06281InvestigationalTorcetrapib (CP-529414, Pfizer) was developed to treat hypercholesterolemia but its development was halted in 2006 when phase III studies showed excessive mortality in the treatment group receiving a combination
Light green SF yellowish
go.drugbank.com/drugs/DB11183ApprovedIt is used in histological applications and other labratory settings, and usually exists as a disodium salt. The maximum absorption of light green SF yellowish is at 630 (422) nm. … Light green SF yellowish is a green triarylmethane dye that is used in the preparation of the staining solution which is widely used as a counterstain.
Synonyms: A F Green No.2, Green No. 2Phenindamine
go.drugbank.com/drugs/DB01619ApprovedPhenindamine is an antihistamine. Phenindamine blocks the effects of the naturally occurring chemical histamine in your body. … Symptoms of a phenindamine overdose include extreme sleepiness, confusion, weakness, ringing in the ears, blurred vision, large pupils, dry mouth, flushing, fever, shaking, insomnia, hallucinations, and
scyllo-inositol
go.drugbank.com/drugs/DB03106InvestigationalAn isomer of glucose that has traditionally been considered to be a B vitamin although it has an uncertain status as a vitamin and a deficiency syndrome has not been identified in man.
Arecoline
go.drugbank.com/drugs/DB04365ExperimentalAn alkaloid obtained from the betel nut (Areca catechu), fruit of a palm tree. It is an agonist at both muscarinic and nicotinic acetylcholine receptors. … It is used in the form of various salts as a ganglionic stimulant, a parasympathomimetic, and a vermifuge, especially in veterinary practice. It has been used as a euphoriant in the Pacific Islands.
Azidocillin
go.drugbank.com/drugs/DB08795ExperimentalAzidocillin is a penicillin antibiotic similir to ampicillin.
LP-2307
go.drugbank.com/drugs/DB17470ExperimentalLP-2307 is an investigational allogeneic large multivalent immunogen (LMI) vaccine developed by Avanir. It was investigated for melanoma.