Search
P54
go.drugbank.com/drugs/DB05451ExperimentalIt inhibits the induction of the enzyme NFkB, thereby inhibiting downstream inflammatory genes such as COX II and iNOS.
Methylnaltrexone
go.drugbank.com/drugs/DB06800ApprovedInvestigationalIt is also a weak CYP2D6 inhibitor. FDA approved in 2008. … Methylnaltrexone is a pheriphally-acting μ-opioid antagonist that acts on the gastrointestinal tract to decrease opioid-induced constipation without producing analgesic effects or withdrawal symptoms.
Rotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedRotenone is an isoflavone compound that naturally occurs in the jicama vine plant as well as many Fabaceae plants. It has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Compounds used in a research, industrial, or household settingCaptodiame
go.drugbank.com/drugs/DB09014ExperimentalCaptodiame, also known as captodiamine, is an antihistamine which is used as a sedative and anxiolytic. It is a derivative of diphenhydramine.
MBT-0312
go.drugbank.com/drugs/DB05880ExperimentalMediGene's newly acquired drug candidates MBT-0312 aim at a novel method of cancer therapy by "starving out" tumors.
Stepronin
go.drugbank.com/drugs/DB01423ExperimentalStrepronin is a mucolytic drug. A mucolytic agent is any agent which dissolves thick mucus usually used to help relieve respiratory difficulties. … The viscosity of mucous secretions in the lungs is dependent upon the concentrations of mucoprotein as well as the presence of disulfide bonds between these macromolecules and DNA.
Ligandrol
go.drugbank.com/drugs/DB13934InvestigationalLigandrol is an investigational selective androgen receptor modulator (SARM) for treatment of conditions such as muscle wasting and osteoporosis.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Polidocanol
go.drugbank.com/drugs/DB06811ApprovedInvestigationalThe formula for Polidocanol has the structural formula C12H25(OCH2CH2)nOH, a mean extent of polymerization (n) of approximately 9 and a mean molecular weight of approximately 600. … Polidocanol is a sclerosing agent indicated to treat uncomplicated spider veins (varicose veins ≤1 mm in diameter) and uncomplicated reticular veins (varicose veins 1 to 3 mm in diameter) in the lower
Categories: Compounds used in a research, industrial, or household setting