Search
Putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase
go.drugbank.com/bio_entities/BE0001689TargetMycobacterium tuberculosisCatalyzes the aldol cleavage of 4-hydroxy-4-methyl-2-oxoglutarate (HMG) into 2 molecules of pyruvate.
Polypeptides: Putative 4-hydroxy-4-methyl-2-oxoglutarate aldolaseFunction: 4-hydroxy-4-methyl-2-oxoglutarate aldolase activityPinaverium
go.drugbank.com/drugs/DB09090ApprovedInvestigationalPinaverium is a spasmolytic agent used for functional gastrointestinal disorders. It is a quaternary ammonium compound that acts as an atypical calcium antagonist to restore normal bowel function. … Although it is not a currently approved drug by the FDA, pinaverium is available in over 60 countries including Canada.
Mixtures: BROMUX D® 100/300 MG CÁPSULA., DUOTRYNE®Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Piperazine
go.drugbank.com/drugs/DB00592ApprovedVet approvedWithdrawnOutside the body, piperazine has a remarkable power to dissolve uric acid and producing a soluble urate, but in clinical experience it has not proved equally successful. … Piperazine is an organic compound that consists of a six-membered ring containing two opposing nitrogen atoms.
Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingProducts: MEI-MEI WORM SYRUP 750 mg/5 ml, PIPOL® JARABEEdoxaban
go.drugbank.com/drugs/DB09075ApprovedInvestigationalEdoxaban is a member of the Novel Oral Anti-Coagulants (NOACs) class of drugs, and is a rapidly acting, oral, selective factor Xa inhibitor. … 10 days of initial therapy with a parenteral anticoagulant.
Categories: P-glycoprotein substrates, Heterocyclic Compounds, 1-RingProducts: LIXIANA 30 MG FILM KAPLI TABLET ,TABLET, 28 ADET, LIXIANA 60 MG FILM KAPLI TABLET ,TABLET, 28 ADETDaclatasvir
go.drugbank.com/drugs/DB09102ApprovedInvestigationalWithdrawn3 patients. … Daclatasvir is a direct-acting antiviral agent against Hepatitis C Virus (HCV) used for the treatment of chronic HCV genotype 1 and 3 infection.
Categories: P-glycoprotein inhibitors, P-glycoprotein substratesProducts: DAKLINZA 30 MG FILM KAPLI TABLET ,FILM KAPLI TABLET, 28 ADET, I-HEP CLASTAVIR 30Aluminum chloride
go.drugbank.com/drugs/DB11081ApprovedInvestigationalAluminum chloride is a chemical compound with the chemical formula AlCl3. When contaminated with iron chloride, it often displays a yellow color compared to the white pure compound. … It is used in various chemical applications as a Lewis base, with anhydrous aluminium trichloride being the most commonly used Lewis acid.
Categories: Compounds used in a research, industrial, or household settingProducts: Gingi Aid Dark Braid #2, Gingi Aid Dark Braid #3Cilazapril
go.drugbank.com/drugs/DB01340ApprovedInvestigationalIt is a prodrug that is hydrolyzed after absorption to its main metabolite cilazaprilat. … It is branded as Inhibace in Canada and other countries, Vascace and Dynorm in a number of European countries, among many other names. None of these varieties are available in the United States.
Mixtures: ACEPRIX PLUS 5 MG/12.5 MG FILM TABLET, 30 ADET, INHIBACE PLUS 5 MG TABLET, 28 ADETCategories: P-glycoprotein inhibitors, Heterocyclic Compounds, 1-RingTopiramate
go.drugbank.com/drugs/DB00273ApprovedInvestigational[L10550] Characteristics that distinguish topiramate from other antiepileptic drugs are a monosaccharide chemical structure containing a sulfamate, and 40% of its mass accounted for by oxygen. … Topiramate is a anti-epileptic drug used to manage seizures and prevent migraines.[A175249] It was initially approved by the FDA in 1996.
Synonyms: 2,3:4,5-bis-O-(1-methylethylidene)-β-D-fructopyranose sulfamate, 2,3:4,5-di-O-isopropylidene-β-D-fructopyranose sulfamateCategories: P-glycoprotein substrates, Cytochrome P-450 CYP3A InducersAzilsartan medoxomil
go.drugbank.com/drugs/DB08822ApprovedInvestigationalIt is also available in a combination product with [chlorthalidone]. … It is a selective AT1 subtype angiotensin II receptor antagonist. Azilsartan medoxomil is a relatively recently-developed antihypertensive drug that was first approved by the FDA in February 2011.
Mixtures: EDARBI CLD®, EDARBYCLOR (TABLETS) 40 MG/12.5 MGCategories: Angiotensin 2 Receptor Blocker, Heterocyclic Compounds, 2-Ring