Search
iCo-007
go.drugbank.com/drugs/DB05268InvestigationaliCo-007 (formerly known as ISIS 13650) is a second generation antisense compound being developed by iCo for the treatment of various eye diseases caused by the formation of new blood vessels (angiogenesis … ) such as age-related macular degeneration (AMD) and diabetic retinopathy(DR).
SARS-CoV-2 Sclamp
go.drugbank.com/drugs/DB15849InvestigationalPreclinical trials showed the vaccine candidate produced high levels of neutralizing antibodies, and induced a strong T-cell response. … The University of Queensland (UQ), in partnership with The Coalition for Epidemic Preparedeness Inovations (CEPI) and CSL has developed a COVID-19 candidate, SARS-CoV-2 Sclamp.
Synonyms: UQ-1-SARS-CoV-2-Sclamp, SARS-CoV-2 Sclamp adjuvanted vaccineATHX-105
go.drugbank.com/drugs/DB06008InvestigationalATHX-105 is an investigational selective 5HT2c receptor agonist developed by Athersys Inc. for the treatment of Obesity.
Ripertamab
go.drugbank.com/drugs/DB16314InvestigationalRipertamab is under investigation in clinical trial NCT02772822 (A Study Comparing the Efficiency and Safety of S-chop(cyclophosphamide, Hydroxydaunomycin, Oncovin, and Prednisone) Versus R-CHOP in Untreated
Synonyms: Immunoglobulin g1-kappa, anti-(homo sapiens ms4a1 (membrane-spanning 4-domains subfamily a member 1, cd20)), chimeric monoclonal antibody, Immunoglobulin igg1, anti-(human cd20 antigen) (human-mus musculus monoclonal disulfide sct400 .gamma.1-chain), disulfide with human-mus musculus monoclonal sct400 .kappa.-chain, dimerE1v1.11
go.drugbank.com/drugs/DB18363ExperimentalE1v1.11 is an antisense oligonucleotide targeting the _SMN2_ gene which is under investigation for the treatment of spinal muscular atrophy (SMA).[L48196]
Synonyms: Phosphorodiamidate morpholino oligomer (5'- CTATATATAGTTATTCAACA -3')SPP1148
go.drugbank.com/drugs/DB05203ExperimentalSPP1148, the most promising compound from a new series of renin inhibitors for the treatment of hypertension and related end-organ disease.
Colforsin
go.drugbank.com/drugs/DB02587InvestigationalPotent activator of the adenylate cyclase system and the biosynthesis of cyclic AMP. From the plant Coleus forskohlii. … Has antihypertensive, positive inotropic, platelet aggregation inhibitory, and smooth muscle relaxant activities; also lowers intraocular pressure and promotes release of hormones from the pituitary gland
Categories: P-glycoprotein inhibitors, Compounds used in a research, industrial, or household settingBisegliptin
go.drugbank.com/drugs/DB06127InvestigationalBisegliptin is a compound for the treatment of type 2 diabetes. … It is an orally active, dipeptidyl peptidase-IV (DPPIV) inhibitor which lowers blood glucose levels by blocking the degradation of the hormone GLP-1 thereby stimulating glucose-dependent insulin secretion
Foselutoclax
go.drugbank.com/drugs/DB21663InvestigationalFoselutoclax is a small molecule drug. The usage of the INN stem '-toclax' in the name indicates that Foselutoclax is a B-cell lymphoma 2 (Bcl-2) inhibitor. … Foselutoclax is under investigation in clinical trial NCT06011798 (Assess the Efficacy and Safety of Repeat Intravitreal Injections of Foselutoclax (UBX1325) in Patients With DME (ASPIRE)).
LGD2941
go.drugbank.com/drugs/DB05234ExperimentalLGD2941 is a non-steroidal, selective androgen receptor modulator (SARM) developed jointly by Ligand and TAP.
Categories: Heterocyclic Compounds, 1-Ring, Heterocyclic Compounds, 2-Ring