Search
ARCoV
go.drugbank.com/drugs/DB15855ExperimentalSARS-CoV-2 mRNA vaccine (ARCoV) is a novel mRNA coronavirus vaccine that consists of a lipid nanoparticle-encapsulated mRNA encoding the receptor binding domain of SARS-CoV-2[A220048]. … As of July 2020, the vaccine candidate is set for Phase 1 clinical trials to investigate for safety, tolerance, and immunogenicity (ChiCTR2000034112).
Otenabant
go.drugbank.com/drugs/DB11745InvestigationalOtenabant has been investigated for the treatment of Obesity.
Danvatirsen
go.drugbank.com/drugs/DB14825InvestigationalDanvatirsen is under investigation in clinical trial NCT03334617 (Phase II Umbrella Study of Novel Anti-cancer Agents in Patients With NSCLC Who Progressed on an Anti-PD-1/PD-L1 Containing Therapy.).
Zilebesiran
go.drugbank.com/drugs/DB18929InvestigationalZilebesiran is under investigation in clinical trial NCT06272487 (Zilebesiran as Add-on Therapy in Patients With High Cardiovascular Risk and Hypertension Not Adequately Controlled by Standard of Care
Synonyms: (2S,4R)-1-{1-[(2-acetamido-2-deoxy-β-D-galactopyranosyl)oxy]-16,16-bis({3-[(3-{5-[(2- acetamido-2-deoxy-β-D-galactopyranosyl)oxy]pentanamido}propyl)amino]-3-oxopropoxy}methyl)-5,11,18-trioxo-14-oxa-6,10,17NS-3728
go.drugbank.com/drugs/DB05835ExperimentalNS3728 is an orally active chloride channel blocker for the treatment of cancer.
Rabeximod
go.drugbank.com/drugs/DB05772InvestigationalRabeximod is an orally administered compound for treatment of moderate or severe active rheumatoid arthritis that is currently undergoing phase II clinical testing in eight European countries.
IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'MIV-701
go.drugbank.com/drugs/DB05736ExperimentalMIV-701 is a selective, potent inhibitor of the protease Cathepsin K. It is developed for the treatment of osteoporosis.
Astaxanthin
go.drugbank.com/drugs/DB06543InvestigationalIt may be found in fish feed or some animal food as a color additive. … Astaxanthin is a keto-carotenoid in the terpenes class of chemical compounds. It is classified as a xanthophyll but it is a carotenoid with no vitamin A activity.
KUR-113
go.drugbank.com/drugs/DB18413InvestigationalKUR-113 is an investigational fibrin-based agent containing an N-terminally modified parathyroid hormone fragment. It is being investigated as a bioactive bone graft substitute.
Synonyms: Fibrin-based agent containing a N-terminally modified parathyroid hormone fragment TGplPTH1-34