Search
Neutramycin
go.drugbank.com/drugs/DB20809ExperimentalNeutramycin is a small molecule drug. The usage of the INN stem '-mycin' in the name indicates that Neutramycin is a antibiotic, produced by Streptomyces strain. … Neutramycin has a monoisotopic molecular weight of 686.35 Da.
Synonyms: Neutramycin a, Chalcomycin, 6-demethyl-IMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Chlorhexidine
go.drugbank.com/drugs/DB00878ApprovedInvestigationalVet approvedWithdrawn[A190417] The molecule itself is a cationic bis-guanide consisting of two 4-chlorophenyl rings and two biguanide groups joined by a central hexamethylene chain. … Chlorhexidine is a broad-spectrum antimicrobial biguanide used as a topical antiseptic and in dental practice for the treatment of inflammatory dental conditions caused by microorganisms.
Synonyms: N,N'-Bis(4-chlorophenyl)-3,12-diimino-2,4,11,13-tetraazatetradecanediimidamide, 1,1'-Hexamethylene bis(5-(p-chlorophenyl)biguanide)International brands: Prevacare RNarasin
go.drugbank.com/drugs/DB11432ExperimentalVet approvedNarasin is an agent with coccidiostatic and antibacterial properties.
Synonyms: Narasin ACategories: Heterocyclic Compounds, 1-RingTrestolone
go.drugbank.com/drugs/DB05830InvestigationalTrestolone (7α-methyl-19-nortestosterone) is a synthetic androgen developed by the Population Council as a potential candidate drug for use in hormonal male contraceptive methods. … In males, regular administration of sufficient quantities of trestolone induces a state of temporary infertility.
Synonyms: 17beta-Hydroxy-7alpha-methylestr-4-en-3-one, 7alpha-Methyl-3-oxo-4-estren-17beta-olTanshinone I
go.drugbank.com/drugs/DB16886ExperimentalSynonyms: Tanshinone A, Tanshinon ICategories: Cytochrome P-450 CYP1A2 Inhibitors, Cytochrome P-450 CYP2C9 InhibitorsDipivefrin
go.drugbank.com/drugs/DB00449ApprovedWithdrawnDipivefrin is a prodrug of adrenaline, which is used to treat glaucoma. It is available as ophthalmic solution (eye drops).
Synonyms: 1-(3',4'-dipivaloyloxyphenyl)-2-methylamino-1-ethanol, (±)-4-[1-hydroxy-2-(methylamino)ethyl]-o-phenylene divavalateInternational brands: D EpifrinClenbuterol
go.drugbank.com/drugs/DB01407ApprovedInvestigationalVet approvedA substituted phenylaminoethanol that has beta-2 adrenomimetic properties at very low doses. It is used as a bronchodilator in asthma.
Mixtures: SEKRETOVIT EX, AMBROXOL 15 MG+ CLENBUTEROL 10 MCG /5 MLCategories: Cytochrome P-450 Substrates, Adrenergic beta-2 Receptor AgonistsSotalol
go.drugbank.com/drugs/DB00489ApprovedInvestigationalSotalol is a methanesulfonanilide developed in 1960.[A178579] It was the first of the class III anti arrhythmic drugs.[A178579] Sotalol was first approved as an oral tablet on 30 October 1992. … [L6334] A racemic mixture of sotalol is currently formulated as a tablet, oral solution, and intravenous injection indicated for life threatening ventricular arrhythmias and maintaining normal sinus rhythm
Synonyms: 4'-(1-hydroxy-2-(isopropylamino)ethyl)methane sulfonanilide, β-cardoneInternational brands: Xi An LinNefazodone
go.drugbank.com/drugs/DB01149ApprovedWithdrawnDrug-induced hepatic injuries were associated with an risk of elevated need for a liver transplant, or even death, with the incidence of severe liver damage was shown to be approximately 1 in 250,000 to … Nefazodone hydrochloride (trade name Serzone) is an antidepressant drug marketed by Bristol-Myers Squibb.
Categories: P-glycoprotein inducers, P-glycoprotein inhibitorsSynonyms: 1-(3-(4-(m-Chlorophenyl)-1-piperazinyl)propyl)-3-ethyl-4-(2-phenoxyethyl)-delta2-1,2,4-triazolin-5-one