Search
Magnesium Aluminum Silicate
go.drugbank.com/drugs/DB11230ApprovedWithdrawnIt is refined to a powder for use in cosmetic and pharmaceutical applications as an absorbent, anticaking agent, opacifying agent, viscosity-increasing agent, suspending agent, tablet and capsule disintegrant … It also has antacid properties and is used as a component of some over the counter antacid medications.
Piperonyl butoxide
go.drugbank.com/drugs/DB09350ApprovedVet approvedPiperonyl butoxide (PBO) is an organic compound used as a component of pesticide formulations. It is used for the treatment of head, pubic (crab), and body lice. Piperonyl butoxide is a synergist. … Piperonyl butoxide is a semisynthetic derivative of safrole.
Mixtures: Lice Enz Aer Shp, R & C Shampoo With ConditionerCategories: Cytochrome P-450 CYP1A2 Inhibitors, Heterocyclic Compounds, 1-RingEplerenone
go.drugbank.com/drugs/DB00700ApprovedInvestigationalEplerenone, an aldosterone receptor antagonist similar to spironolactone, has been shown to produce sustained increases in plasma renin and serum aldosterone, consistent with inhibition of the negative
Categories: Cytochrome P-450 Substrates, Cytochrome P-450 CYP3A SubstratesProducts: ACENOL® 25 MG, EPNONE® 50 TABLETA RECUBIERTALotilaner
go.drugbank.com/drugs/DB17992ApprovedInvestigationalVet approvedLotilaner is an ectoparasiticide that is a member of the isoxazoline family of compounds. … [L47546] Lotilaner has largely been used for veterinary uses as an antiparasitic agent to treat flea and tick infestations in animals.
Categories: Heterocyclic Compounds, 1-RingSynonyms: 2-thiophenecarboxamide, 5-((5s)-4,5-dihydro-5-(3,4,5-trichlorophenyl)-5-(trifluoromethyl)-3-isoxazolyl)-3-methyl-n-(2-oxo-2-((2,2,2-trifluoroethyl)amino)ethyl)-, 3-methyi-n-(2-oxo-2-((2,2,2-trifluoroethyl)amino)ethyl)-5-((55)-5-(3,4,5-trichlorophenyl)-5-(trifluoromethyl)-4,5-dihydro-1,2-oxazol-3-yl)thiophene-2-carboxamideZuranolone
go.drugbank.com/drugs/DB15490ApprovedInvestigational[A260776,A260786] Zuranolone was designed with a pharmacological profile of a neuroactive steroid in mind while also possessing a pharmacokinetics profile of an oral, once-daily dosing formulation. … Unlike other more common GABA<sub>A</sub> positive allosteric modulators on the market like benzodiazepines, zuranolone can modulate both synaptic and extrasynaptic GABA<sub>A</sub> conductance due to
Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingLacidipine
go.drugbank.com/drugs/DB09236ApprovedLacidipine is a lipophilic dihydropyridine calcium antagonist with an intrinsically slow onset of activity. … calcium antagonists, thiazide diuretics, atenolol (a beta-blocker) and enalapril (an ACE inhibitor) [A31536].
Categories: Cytochrome P-450 Substrates, Heterocyclic Compounds, 1-RingProducts: LACIPIL TABLET 4 mg, LACIPIL 4 MG FILM KAPLI TABLET, 14 ADETTechnetium Tc-99m oxidronate
go.drugbank.com/drugs/DB09139ApprovedWithdrawn[L1138] These complexes are formed by the binding of 99mTc to metal atoms of an organic molecule. … [L1137] The radiopharmaceuticals based on technetium-99m are widely used for diagnostic purposes because 99mTc has a versatile chemistry which allows it to produce an extense variety of complexes with
Mafenide
go.drugbank.com/drugs/DB06795ApprovedVet approvedWithdrawnIn November 2022, the use of mafenide acetate (powder for 5% topical solution) was withdrawn by the FDA due to an unresolved confirmatory study required to fulfill the accelerated approval requirements … Mafenide is a sulfonamide-type antimicrobial agent used to treat severe burns. It acts by reducing the bacterial population present in the burn tissue and promotes healing of deep burns.
Synonyms: 4-Homosufanilamide, 4-(aminomethyl)benzenesulfonamideIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Asenapine
go.drugbank.com/drugs/DB06216ApprovedInvestigationalIt is also for severe post-traumatic stress disorder nightmares in soldiers as an off-label use. FDA approved on August 13, 2009. … Developed by Schering-Plough after its merger with Organon International, asenapine is a sublingually administered, atypical antipsychotic for treatment of schizophrenia and acute mania associated with
Categories: Cytochrome P-450 Substrates, Adrenergic alpha-1 Receptor Antagonists