Search
Luxeptinib
go.drugbank.com/drugs/DB19179InvestigationalSynonyms: Urea, n-(4-(2,3-dihydro-7-(5-methyl-1h-imidazol-2-yl)-1-oxo-1h-isoindol-4-yl)-3-fluorophenyl)-n'-(2,4,6-trifluorophenyl)-, 32,72,74,76-tetrafluoro-14-methyl-21,23-dihydro-11h-4,6-diaza-2(4,7)-isoindola- 1(2)-imidazola-3(1,4),7(1)-dibenzenaheptaphane-2,35-dioneNifedipine
go.drugbank.com/drugs/DB01115ApprovedInvestigationalNifedipine, or BAY a 1040, is a first generation dihydropyridine L-type calcium channel blocker, similar to [nicardipine]. … [A190210,A190273,A175390,L11383] Nifedipine was developed by Bayer and first described in the literature, along with other dihydropyridines, in 1972.
Mixtures: NIF TEN 50, NIF-TEN CAPSULECategories: P-glycoprotein inducers, P-glycoprotein inhibitorsEnalapril
go.drugbank.com/drugs/DB00584ApprovedInvestigationalVet approvedIt is also found in a combination product containing [hydrochlorothiazide] that is used for the management of hypertension. … Enalapril is a prodrug belonging to the angiotensin-converting enzyme (ACE) inhibitor drug class that works on the renin-angiotensin-aldosterone system, which is responsible for the regulation of blood
Mixtures: DUOPRES® 5 MG / 20 MG CÁPSULAS, DUOPRES ® 5 MG / 10 MG CÁPSULASCategories: P-glycoprotein inhibitors, Agents Acting on the Renin-Angiotensin SystemDesloratadine
go.drugbank.com/drugs/DB00967ApprovedInvestigationalDesloratadine is a second generation, tricyclic antihistamine that which has a selective and peripheral H1-antagonist action. … It is the active descarboethoxy metabolite of loratidine (a second generation histamine).
Mixtures: DESCASE 5 MG / 10 MG FILM KAPLI TABLET ,90 ADET, DESCASE 5 MG / 10 MG FILM KAPLI TABLET ,30 ADETCategories: P-glycoprotein inhibitors, Heterocyclic Compounds, 1-RingUrsodeoxycholic acid
go.drugbank.com/drugs/DB01586ApprovedInvestigational[A256272,A256277] UDCA has been used to treat liver disease for decades: its first use in traditional medicine dates back more than a hundred years. … [A256267,A256463] UDCA was first characterized in the bile of the Chinese black bear and is formed by 7b-epimerization of [chenodeoxycholic acid], which is a primary bile acid.
Categories: Cytochrome P-450 CYP3A Inducers, Cytochrome P-450 Enzyme InducersSynonyms: (3α,5β,7β)-3,7-dihydroxycholan-24-oic acidRotenone
go.drugbank.com/drugs/DB11457ExperimentalVet approvedRotenone is an isoflavone compound that naturally occurs in the jicama vine plant as well as many Fabaceae plants. It has broad spectrum insecticide and pesticide activity and is also toxic to fish.
Categories: Compounds used in a research, industrial, or household setting, Heterocyclic Compounds, 1-RingSynonyms: 5'β-rotenone, [2R-(2α,6aα,12aα)]-1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)[1]benzopyrano[3,4-b]furo[2,3-H][1]benzopyran-6(6aH)-onePheniramine
go.drugbank.com/drugs/DB01620ApprovedPheniramine is a first-generation antihistamine in the alkylamine class, similar to [brompheniramine] and [chlorpheniramine]. … [A181628] It is used in some over-the-counter allergy as well as cold & flu products in combination with other drugs.
Mixtures: ANTIBEKSIN SURUP, 100 ML, OCTILIA ALLERGIA E INFIAMMAZIONECategories: Heterocyclic Compounds, 1-RingIMT504
go.drugbank.com/drugs/DB17792InvestigationalIMT504, a non-CpG 24-mer oligodeoxynucleotide, is an immunomodulatory oligonucleotide currently being investigated as a rabies vaccine.[A259467]
Synonyms: DNA, D(P-THIO)(T-C-A-T-C-A-T-T-T-T-G-T-C-A-T-T-T-T-G-T-C-A-T-T), PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5'TCATCATTTTGTCATTTTGTCATT 3'Levosimendan
go.drugbank.com/drugs/DB00922ApprovedInvestigationalWithdrawnLevosimendan increases calcium sensitivity to myocytes by binding to troponin C in a calcium dependent manner. This increases contractility without raising calcium levels. … Levosimendan is under investigation in clinical trial NCT00527059 (Renal Effects of Levosimendan in Patients Admitted With Acute Decompensated Heart Failure).
Categories: Compounds used in a research, industrial, or household setting, Heterocyclic Compounds, 1-RingProducts: SIMDAX 2.5 MG/ML KONSANTRE INF.COZ.5 ML X FLAKON, 1 ADET, LEVOSIMENDAN EGMinnelide
go.drugbank.com/drugs/DB17309InvestigationalSynonyms: Trisoxireno(4b,5:6,7:8a,9)phenanthro(1,2-c)furan-1(3h)-one, 3b,4,4a,6,6a,7a,7b,8b,9,10-decahydro-8b-methyl-6a-(1-methylethyl)-6-((phosphonooxy)methoxy)-, sodium salt (1:2), (3bs,4as,5ar,6r,6as,7as,7bs,, 14-o-phosphonooxymethyltriptolide disodium salt